Особенности статуса ип: Правовой статус индивидуального предпринимателя

Правовой статус индивидуального предпринимателя

Особенности статуса ИП

Многие начинающие реализацию собственных бизнес идей предприниматели встают перед выбором организационно правовой формы этого бизнеса. И как правило, сразу же сталкиваются с необходимостью сопоставить плюсы и минусы различных форм организации, а следовательно и с необходимостью определить свой потенциальный правовой статус при выборе того или иного варианта.

Правовой статус индивидуального предпринимателя – это не совсем однозначный вопрос, так как такая форма хозяйствования как ИП объединяет в себе признаки и юридических лиц и физических.

ИП – это физическое или юридическое лицо

Первый вопрос, который является камнем преткновения, — это вопрос является ли ИП физическим или юридическим лицом. Чтобы ответить на него, необходимо обратиться к ст.23 Гражданского Кодекса РФ, в которой дается определение для физ. лиц, ведущих предпринимательскую деятельность. Итак, индивидуальный предприниматель – это гражданин, занимающийся предпринимательской деятельностью без образования юридического лица. Таким образом, действующий закон однозначно исключает ИП из юридических лиц.

В то же время, однозначно относить ИП к рядовым гражданам также нельзя, так как в связи с участием в предпринимательской деятельности они наделены специфическими правами и обязанностями.

Поэтому правильнее будет определять ИП как отдельную категорию граждан (физических лиц), не являющихся юридическим и лицами, но ведущими предпринимательскую деятельность и в связи с этим обладающие особенными правами и обязанностями, но только в тех сферах, которые связаны с такой деятельностью, а во всех остальных они выступают как рядовые граждане.

Особенности правового статуса ИП

Что касается правового статуса индивидуального предпринимателя, то в силу двойственности положения ИП и природа его статуса также двойственна – с одной стороны ИП участвует в хозяйственной деятельности, но при этом никакого хозяйствующего субъекта не образует. Поэтому перечень прав гражданина, получившего статус ИП, имеет свои особенности – это:

  • Самое главное право, которое дает статус ИП – это право вести предпринимательскую деятельность.

    При этом существуют ограничения на виды деятельности, доступные для ИП, например, ИП не может заниматься реализацией алкогольной продукцией или частной охранной практикой. Поэтому если вы планируете начать деятельность в таких сферах, вам придется регистрировать ООО.

  • Правовой статус индивидуального предпринимателя не предполагает разделения имущества гражданина на участвующее или не участвующее в хозяйственной деятельности. Это имеет как преимущества (например, можно использовать личный автомобиль для получения дохода), так и недостатки –в случае неисполнения обязательств перед кредиторами в счет уплаты долгов возможно изъятие собственности ИП как физ. лица (того же автомобиля, квартиры, земельных участков) даже если эта собственность не использовалась в предпринимательской деятельности.
  • ИП обязан своевременно оплачивать налоги в соответствии с выбранной формой налогообложения, а также вносить обязательные взносы в ПФР.
  • При наличии работников ИП обязан выступать в роли их налогового и страхового агента и вносить за них плату в соответствующие бюджетные фонды.
  • В случаях судебных разбирательств в отношении лиц, имеющих правовой статус индивидуального предпринимателя, первое, что необходимо сделать – определить в качестве кого действовал гражданин в момент правонарушения – как ИП или как физическое лицо. В зависимости от сделанного определения, судебное дело передается либо в арбитражный, либо в суд общей юрисдикции.
  • В ряде регионов индивидуальные предприниматели пользуются поддержкой со стороны местных органов власти и получают определенные льготы, направленные на развитие малого бизнеса.

Плюсы и минусы статуса ИП

Естественно, что двойственное положение ИП имеет как сильные, так и слабые стороны, поэтому важно определить преимущества и недостатки правового статуса индивидуального предпринимателя.

Подробно о преимуществах и недостатках ИП как формы организации бизнеса вы можете прочитать в статье «Минусы и плюсы ИП». Здесь же мы поговорим только о правовом статусе ИП.

Плюсы статуса ИП

  1. Расширенные, по сравнению с обычными гражданами, права и обязанности ИП – право вести коммерческую деятельность.
  2. Освобождены от уплаты налога на доходы физических лиц.
  3. Минимальные расходы на регистрацию статуса ИП, минимальный комплект документов.
  4. Штрафы, накладываемые на предпринимателей в несколько раз меньше, чем штрафы для юр.лиц.
  5. Расчетный счет и печать не являются обязательными требованиями для ИП.
  6. ИП может самостоятельно распоряжаться доходами, полученными от бизнеса (ООО вынуждены ждать распределения прибыли).
  7. Облегченный режим использования имущества – и сам ИП и члены его семьи могут свободно распоряжаться всем имеющимся имуществом, без разделения на использующееся в коммерческой деятельности или нет.
  8. Возможность совмещать предпринимательскую деятельность с любыми другими формами взаимоотношений в обществе в качестве физического лица.

Минусы статуса ИП

  1. ИП отвечает по своим обязательствам собственным имуществом, поэтому потенциальные риски для граждан, являющихся ИП, гораздо выше, чем, например, для участников ООО.
  2. Обязанность по оплате налогов и сдаче отчетности за себя, а также обязательное выполнение функции налогового и страхового агента за нанимаемых работников (если они есть).
  3. Обязанность по оплате фиксированного взноса в ПФР, даже при отсутствии фактической деятельности в отчетном периоде.
  4. Ограничения на доступные для ИП виды деятельности.
  5. Субъективно предпочтения многих потенциальных партнеров по бизнесу отдаются в пользу юридических лиц, а не ИП.
  6. Если ИП начинает бракоразводный процесс, то все имущество делится между супругами поровну (если иное не предусмотрено брачным договором).

Таким образом, двойственный правовой статус индивидуального предпринимателя предполагает как преимущества, так и недостатки, которые могут как способствовать, так и наоборот – мешать развитию вашего бизнеса. Имущественная ответственность ИП, которая останавливает многих начинающих предпринимателей, на самом деле не должна смущать, если вы собираетесь честно и внимательно вести начатое дело, не пытаться уклоняться от взятых на себя обязательств и здраво оценивать имеющиеся риски от того или иного варианта вложения средств.

Гражданско-правовой статус индивидуального предпринимателя в РФ

Выбор организационно-правовой формы – значимый шаг предпринимателя на старте карьеры. Правовой статус индивидуального предпринимателя отлично подойдет физическим лицам, желающим открыть собственное дело. Ведь его главное отличие в том, что руководитель может обойтись и без глубоких познаний в бухучете, и без бухгалтера. Но и в этой сфере без подводных камней не обойтись. Так какие же особенности таит в себе правосубъектность ИП?

Получение правового статуса предпринимателя

Получить правовой статус ИП могут далеко не все желающие. Главными условиями для этого являются дееспособность, достижение совершеннолетнего возраста и наличие РВП (разрешение на временное проживание) или ВНЖ (вид на жительство) в РФ.

Получить правовой статус ИП могут далеко не все желающие.

Если желание открыть свой бизнес велико, а совершеннолетие так и не наступило, существует возможность получения согласия от родителей (опекунов) на открытие собственного дела, решения суда о дееспособности, а также вступления в подлинный брак.

Не имеют права получения статуса ИП:

  1. Лица, раннее уже получившие и не ликвидировавшие этот статус, – по Закону № 129-ФЗ «О государственной регистрации…», двух ИП у одного физлица быть не может.
  2. Лица, получившие отказ в приобретении правового статуса ИП по решению суда (Закон № 129-ФЗ, ст. 22.1, п. 4).
  3. Особы, судимые по следующим статьям УК РФ: ст. 105-125, ст. 228-245, ст. 126-127, ст. 275-284, ст. 131-135, ст. 205-227, ст. 150-157.
  4. Работники муниципальных учреждений, госслужащие.
  5. Лица, имеющие наркотическую зависимость.
  6. Лица с ограниченной дееспособностью.
  7. Граждане зарубежных стран, не имеющие официального документа на проживание и ведение бизнеса в России.

Характерные черты предпринимательского статуса

Гражданско-правовое положение ИП позволяет вести предпринимательскую деятельность, однако есть и ограничения. Например, ИП не имеет права реализовывать алкогольные продукты. Поэтому, если планируемая деятельность связана с этой продукцией, потребуется регистрация ООО.

Гражданско-правовое положение ИП позволяет вести предпринимательскую деятельность, однако есть и ограничения.

Согласно статье 23 ГК РФ, ИП не является юридическим лицом. Индивидуального предпринимателя можно назвать физическим лицом, имеющим особые права и обязанности в своей сфере деятельности.

Предпринимательский статус не ставит четких границ между имуществом предпринимателя, относящимся к бизнесу, и его же как гражданина РФ. Это значит, предприниматель может пользоваться собственным авто во благо предприятия, но его могут и забрать за неуплату долгов.

Предприниматель в обязательном порядке должен выплачивать налоги и делать взносы в Пенсионный фонд России. Если ИП нанял на предприятие других сотрудников, он должен оплачивать за них налоги и страховые взносы в соответствующие инстанции.

Некоторые регионы стараются поддерживать инициативу малого бизнеса и наделяют его льготами. Подробнее можно узнать в юридических документах своего региона.

Преимущества и недостатки правового статуса предпринимателя

В работе ИП есть своя специфика, поэтому однозначно ответить на вопрос, хорошо это или плохо, затруднительно. Преимуществами статуса ИП, несомненно, можно считать:

  • Право ведения коммерческой деятельности.
  • Освобождение от уплаты налогов на доходы физлиц.
  • Возможность не открывать расчетный счет для малого бизнеса.
  • Самостоятельное распределение бюджета предприятия (юрлицам оперировать счетами компании сложнее).
  • Возможность сочетания коммерческой деятельности с другими видами общественных отношений в качестве физлица.

Недостатками правового статуса предпринимателя считают:

  • Обязательства, связанные с уплатой налогов и подачей отчетностей за себя и наемных работников (если таковые имеются).
  • Оплата взносов в Пенсионный фонд даже при отсутствии деятельности в определенный промежуток времени.
  • Табу на ведение некоторых видов деятельности.
  • Имущество ИП при расторжении брака делится пополам между супругами (если данный пункт не прописан в брачном контракте).

Отсутствие разделения имущества между статусом ИП и физическим лицом можно считать как положительной чертой (возможность использовать собственное имущество в бизнесе), так и отрицательной (гражданское имущество может изыматься в качестве неуплаты задолженностей по бизнесу).

Но все же индивидуальное предпринимательство – это огромный шаг на пути к большому бизнесу. Ведь это несложно и абсолютно легально. Но выбор формы предпринимательства зависит от многих факторов (не только простоты/сложности). Поэтому внимательно изучите особенности правового статуса индивидуального предпринимателя и других форм коммерческой деятельности на нашем сайте, чтобы принять окончательное решение.

Правовой статус индивидуального предпринимателя в России (Курсовая работа)

Содержание:

Введение

Глава 1. Сущность статуса
индивидуального предпринимателя

1.1. Понятие предпринимательской
деятельности граждан

1.2.Государственная регистрация
индивидуального предпринимателя

1.3. Сравнительная характеристика
правового положения

индивидуального предпринимателя
и юридического лица

Глава 2. Особенности ответственности
индивидуального

предпринимателя

2.1. Ответственность индивидуального
предпринимателя

2.2. Утрата статуса индивидуального
предпринимателя

Глава 3. Конституционные гарантии
предпринимательской

деятельности в России

Заключение

Список использованной литературы

Введение

Конституционная модель российской
экономики весьма далека от своего
воплощения в жизнь. Внедрение
предпринимательства пока не привело к
ожидаемым стабилизации и росту народного
хозяйства, а сама предпринимательская
деятельность характеризуется сложностью
и глубокими внутренними противоречиями.
В практике хозяйствования и
нормативно-правовом регулировании
необходимо учитывать складывающиеся
тенденции с тем, чтобы активно влиять
на положительные процессы и максимально
устранять отрицательные явления.

В пользу актуальности вопроса
о предпринимательстве говорят следующие
факты: все более утверждается представление
о предпринимательстве как многообразном
явлении современной России, воздействующем
на государственную и общественную
жизнь; можно говорить о наступлении
более высокой степени зрелости самих
российских предпринимателей;
предпринимательство тесно связано и
непрерывно взаимодействует со всеми
сферами общества.

В нашей республике тема
предпринимательства также не обойдена
вниманием, например, президент КБР В.М.
Коков очень часто в своих заявлениях
говорит о том, что в республике создаётся
благоприятный климат для развития
малого предпринимательства, снижаются
налоги, существует система льгот и
поощрений. На волне предвыборных компаний
многие кандидаты определяют в своих
программах приоритетной целью поддержку
и развитие малого бизнеса.

В свете сказанного актуальность
темы курсовой работы очевидна. Итак,
цель работы – исследовать вопрос о
правовом положении индивидуальных
предпринимателей. Для достижения цели
поставлены следующие задачи:

  • изучить институт индивидуального
    предпринимательства в Российской
    Федерации;

  • исследовать действующее
    российское законодательство и дать
    определение предпринимательской
    деятельности граждан;

  • дать сравнительную характеристику
    правового положения индивидуального
    предпринимателя и юридического лица;

  • проанализировать конституционные
    гарантии индивидуального предпринимательства.

Проблема индивидуального
предпринимательства является достаточно
исследованной. В курсовой работе были
использованы учебные пособия по
гражданскому праву, предпринимательскому
праву, основам бизнеса, современное
российское законодательство (Конституция
РФ, Гражданский кодекс РФ), монографии
и статьи юридических изданий, справочные
издания.

Глава 1.Сущность статуса
индивидуального предпринимателя

1.1. Понятие предпринимательской
деятельности граждан

Общепризнанно,
что основой рыночной экономики является
частная собственность, представляющая
собой активы, которые принадлежат
частным лицам как часть их богатства.
Для анализа и выработки возможных
решений в современных социально-экономических
условиях важно представлять как всю
структуру экономики частного
предпринимательства, так и необходимое
их единство и соотношение различных
секторов, входящих в неё.

Известно,
что частный сектор в совокупности с
государственным сектором образует
внутреннюю экономику страны и вместе
с иностранным сектором формирует
национальную экономику.

Частный
сектор, в свою очередь, как часть экономики
состоит из индивидуального сектора,
корпоративного и финансового. Отсюда
можно сделать вывод, что эффективность
экономической реформы зависит от того,
как развивается вся система, все составные
части экономики, а не отдельные её
составляющие.

Особую группу полностью
дееспособных граждан составляют лица,
занимающиеся предпринимательской
деятельностью без образования юридического
лица.

В соответствии со ст. 37 Конституции
РФ гражданин имеет право свободно
распоряжаться своими способностями к
труду, выбирать род деятельности и
профессию. Гражданско-правовой формой
реализации этого права может являться
деятельность в качестве индивидуального
предпринимателя.

Понятие предпринимательской
деятельности определено п. 1 ст. 2 ГК РФ:
это самостоятельная, осуществляемая
на свой риск деятельность, направленная
на систематическое получение прибыли
от пользования имуществом, продажи
товаров, выполнения работ или оказания
услуг лицами, зарегистрированными в
этом качестве в установленном законом
порядке.

Следовательно, существенными
признаками предпринимательской
деятельности являются:

1) коммерческая направленность
деятельности;

2) систематический характер
деятельности;

3) государственная регистрация
гражданина в качестве индивидуального
предпринимателя;

4) самостоятельная имущественная
ответственность. Индивидуальный
предприниматель, таким образом, выступает
на одинаковых правах с юридическими
лицами в сфере потребительского рынка
и услуг.1

При осуществлении предпринимательской
деятельности в сельском хозяйстве
предпринимателем признается глава
крестьянского (фермерского) хозяйства.
Такое хозяйство может состоять из одного
лица. Если в деятельности хозяйства
участвуют трудоспособные члены его
семьи, другие родственники и иные лица,
то они предпринимателями не являются.
В качестве предпринимателя выступает
только глава крестьянского (фермерского)
хозяйства. Глава крестьянского
(фермерского) хозяйства, осуществляющий
деятельность без образования юридического
лица, признается предпринимателем с
момента государственной регистрации
крестьянского (фермерского) хозяйства,
т. е. отдельной регистрации главы
хозяйства не требуется.2

В содержание дееспособности
граждан-предпринимателей включены
дополнительные правовые возможности
и обязанности. Они вправе заниматься
такой деятельностью, которую осуществляют
юридические лица — коммерческие
организации и которой не могут заниматься
другие граждане.

Исходя из этого увеличивается
объем возможных сделок для
граждан-предпринимателей. В то же время
круг сделок, совершаемых главой
крестьянского (фермерского) хозяйства
как предпринимателем, ограничен целями
деятельности этого хозяйства:
производством, переработкой и реализацией
сельскохозяйственной продукции.

В случаях, когда в предпринимательской
деятельности участвуют лица, обладающие
частичной дееспособностью, такие лица
совершают юридические действия с
согласия законных представителей —
родителей, усыновителей, попечителя
(абз. 1 п. 1 ст. 27 ГК РФ).

Рассмотрим
преимущества и недостатки индивидуального
предпринимательства.

Преимущества
заключаются в следующем:

  1. получение
    разрешения на предпринимательскую
    деятельность упрощено по сравнению с
    хозяйственными товариществами:
    индивидуальный предприниматель имеет
    право заниматься предпринимательской
    деятельностью без образования
    юридического лица с момента государственной
    регистрации.

Правовой статус ИП: сильные и слабые стороны

Действующим законодательством предоставляется право заниматься предпринимательством в перечисленных им формах. Одна из них – индивидуальный предприниматель.

Общая характеристика

Правовой статус индивидуального предпринимателя – это правовое положение указанной категории граждан, предопределяющее объем прав и обязанностей, пределы ответственности и защиты. Особенность характеризуется в его двойственности как гражданина (физического лица) и как субъекта коммерческой деятельности. Поэтому подлежат применению нормы, регламентирующие деятельность корпораций и физических лиц (граждан).

Значение для статуса индивидуального предпринимателя имеет характер и вид деятельности, которая предполагает личную трудовую занятость лица, зарегистрированного в установленном порядке как ИП.

Другие качества, которыми обладает рассматриваемый статус, это:

  • предприниматель выступает от своего имени;
  • самостоятельность коммерческой деятельности;
  • цель – достижение экономического результата, извлечение прибыли;
  • повышенная имущественная ответственность.

Индивидуальным предпринимателем вправе стать гражданин РФ, иностранец или лицо без гражданства. Это не влияет на общее содержание прав и обязанностей, за исключением ограничений по видам деятельности. ИП может стать дееспособное лицо, в том числе и несовершеннолетний при соблюдении указанных в законе условий. Так, 14-летний подросток вправе осуществлять деятельность в рамках рассматриваемого статуса с согласия своих родителей (опекунов, попечителей). Лица, лишенные дееспособности вследствие психического заболевания либо недееспособные по иным основаниям, не могут быть предпринимателями.

Нельзя забывать, что некоторым гражданам запрещается заниматься предпринимательской деятельностью в силу указания закона или на основания решения суда (государственные и муниципальные служащие, депутаты, лица, к которым применена такая мера наказания и т.п.).

Для правомерности осуществления предпринимательской деятельности требуется соблюсти административный порядок и зарегистрироваться как ИП. Государственными органами, уполномоченными актировать факт получения лицом статуса ИП, названы налоговые органы. Регистрация производится посредством занесения в государственный реестр соответствующих сведений о приобретении гражданами статуса индивидуального предпринимателя, его закрытия, иных необходимых.

Преимущества правового статуса ИП

Выделяются следующие основные положительные моменты рассматриваемого статуса.

По сравнению с коммерческими организациями:

  • законодательство предусматривает более простой административный порядок регистрации и прекращения статуса индивидуального предпринимателя;
  • ИП предоставлено больше вариантов использования упрощенного порядка налогообложения, например, патентный режим;
  • у организации обязательно должен быть самостоятельный баланс (смета), вестись бухучет. На предпринимателей-индивидуалов не возлагается такой обязанности. Они ведут исключительно учет доходов и расходов для исполнения налоговых обязанностей.
  • используя имущество в коммерческой деятельности, ИП не обязан его каким-либо образом обособлять от остального, он и его семья продолжают им пользоваться и распоряжаться в обычном порядке;
  • ИП проще распорядиться доходами, полученными от предпринимательской деятельности. Участникам (акционерам) организации для получения прибыли требуется дождаться решения собрания, которое принимается только при соблюдении определенных условий.

По сравнению с обычными гражданами:

  • получение соответствующего статуса в установленном законом порядке устраняет перспективу привлечения лица, занимающегося коммерческой деятельностью, к ответственности за незаконное предпринимательство;
  • не требуется платить налог (НДФЛ) на доходы, полученные в результате предпринимательской деятельности;
  • возможность трудовой деятельности не только как ИП, но и по трудовому договору;
  • расширяются возможности заключения большого количества контрактов и увеличения прибыли, так как многие поставщики предпочитают не работать с физическими лицами, рассматривая их как розничных покупателей.

Отрицательные стороны правового положения ИП

Капитал корпораций формируется за счет взносов (вкладов) учредителей (участников, акционеров), права последних на это имущество прекращаются. Этим капиталом организация и отвечает по требованиям кредиторов. Учредители не участвуют в этом процессе.

Индивидуальный предприниматель же не производит обособленного учета имущества, используемого в коммерческой деятельности, несет ответственность в полном объеме всем, что ему принадлежит.

Кроме того, такой режим несет для ИП и дополнительные риски утраты собственности используемой для коммерции. В результате развода, последующего за ним раздела имущества или обращения взыскания по долгам супруга предприниматель может остаться без основных средств, с помощью которых ведет бизнес (автотранспорта, объекта недвижимости и т.п.). Избежать возникновения подобных проблем возможно при заключении соответствующего брачного договора.

Индивидуальный предприниматель вправе осуществлять ограниченный перечень видов деятельности.

Так, он не вправе продавать алкоголь (иные товары: лекарственные средства, оружие и т.п.), открыть инвестиционный фонд, перевозить пассажиров и грузы на некоторых видах транспорта (например, воздушном) и т. п. В случае нарушения указанного запрета, ему грозят административные или уголовные санкции.

Для использования некоторых упрощенных систем налогообложения требуется приобретение в административном порядке патента, что ведет к дополнительным расходам предпринимателя.

Независимо от активности предпринимательской деятельности ИП с момента регистрации обязан регулярно сдавать в предусмотренном законом порядке отчетность и исполнять иные обязанности хозяйствующих субъектов.

При найме работников на индивидуального предпринимателя распространяется в полном объеме статус работодателя, в том числе соответствующие обязательства, предусмотренные трудовым и налоговым законодательством (вести кадровое делопроизводство, перечислять НДФЛ как налоговый агент и т.п.).

Ответственность ИП

В случае если лицо в рамках осуществления своей обычной коммерческой деятельности нарушает действующее законодательство, оно привлекается к имущественной, административной, уголовной ответственности. Такой риск присутствует и у индивидуальных предпринимателей. При этом он становится субъектом ответственности и как бизнесмен, и как гражданин.

Административная ответственность предполагает нарушения как налогового, так и трудового, таможенного и иного законодательства. Практика показывает, что стандартными нарушениями для предпринимателя становятся несвоевременные сдача отчетности, уплата налогов, взносов в фонды, иные административные проступки.

Вследствие ненадлежащего исполнения обязанностей по договорам ИП привлекается к гражданско-правовой ответственности, что свыше пятидесяти процентов случаев приводит к разбирательствам в суде: при торговле товарами ненадлежащего качества (в отношении потребителей), неоплаты или просрочки оплаты товара. Этот вид ответственности носит материальный характер и предполагает применение финансовых санкций в виде штрафов, пеней, иного возмещения вреда.

За свершение тяжких правонарушений в области бизнес-деятельности (преступлений) ИП наступает риск уголовной ответственности как гражданина: за торговлю алкогольной продукцией, оружием, иные виды незаконного предпринимательства. Размеры санкций в рамках этого вида ответственности строже, чем при административной.

Особенности защиты прав ИП

Характерной для статуса индивидуального предпринимателя чертой признается и то, что если спор с его участием носит экономический характер, и другой стороной выступает тоже бизнес-субъект, он подлежит рассмотрению арбитражным судом. А конфликты с гражданами (потребителями) либо споры, в которых ИП выступает не как бизнесмен, — предмет разбирательства судов общей юрисдикции.

Таким образом, двойное положение ИП проявляется и в особенностях защиты прав, предоставляя ему право действовать и как субъекту предпринимательской деятельности, и как физическому лицу (гражданину).

Кроме судебной защиты, предприниматель вправе воспользоваться и иными способами защиты, в частности, в отношении актов госорганов, обжаловать их в административном порядке.

Кроме того, на ИП распространяется требование соблюдения досудебного урегулирования спора в случае возникновения такого конфликта из экономической деятельности.

Прекращение статуса ИП. Банкротство

В случае принятия гражданином решения о прекращении самостоятельной предпринимательской деятельности он вправе совершить действия по добровольному закрытию. Утрата статуса происходит после внесения соответствующей информации в ЕГРИП согласно установленным законом административным процедурам.

Наличие у предпринимателя долгов по налогам и иным обязательным платежам – не основание для отказа в действиях по прекращению его деятельности.

Ликвидация ИП предусматривает упрощенный порядок по сравнению с подобными процедурами для организаций.

Необходимые регистрационные действия реализуют налоговые органы. После проведения проверок они вносят запись о прекращении лицом предпринимательской деятельности в ЕГРИП и выдают уведомление бывшему предпринимателю.

В случае, когда индивидуальный предприниматель не способен удовлетворить денежные требования кредиторов и/или оплатить налоги и иные обязательные платежи, он признается банкротом. С 1 октября 2015 года претерпело изменения законодательство по этому вопросу.

Дела о банкротстве ИП или граждан, утративших этот статус при наличии непогашенных обязательств в результате предпринимательской деятельности, подлежат рассмотрению в рамках арбитражного судопроизводства.
По результатам решения суда о признании лица банкротом вводится правовая процедура реализации принадлежащего ему имущества, которая происходит согласно гражданскому процессуальному законодательству, и утрачивается статус ИП.

Правовой статус индивидуального предпринимателя (ИП)

Граждане, которые зарегистрировались в органах государственной власти с целью занятия предпринимательской деятельностью, приобретают статус ИП. Это право за гражданами закреплено статьей 23 ГК РФ.

В случае принятия решения физическим лицом о занятии предпринимательской деятельностью, но при этом без прохождения регистрации в органах власти, действия таких лиц приведут к привлечению их к административной или уголовной ответственности (п. 3 статья 401ГК РФ). Здесь следует понимать, что источник доходов у физического лица должен быть не разовым, а постоянным.

В качестве ИП могут быть зарегистрированы только дееспособные лица от 18 лет и выше. При выборе рода деятельности для предпринимательства гражданину необходимо знать, что некоторые виды работ требуют профессиональных навыков и соответствующего образования.

Так, например, для занятия аудиторской деятельностью необходимо иметь аттестат аудитора, что предусмотрено Федеральным законом «Об аудиторской деятельности». У арбитражного управляющего как предпринимателя должно быть высшее образование, общий стаж работы — два года и более, отсутствие судимости, связанной с экономическими вопросами или преступлений средних, тяжких или особо тяжких. Для занятия такой деятельностью необходимо сдать экзамен. В течение шести месяцев — обязательно пройти стажировку помощником арбитражного управляющего. Эти требования предусмотрены Федеральным законом, регулирующим процедуру банкротства.

Кроме этого, существуют виды деятельности, которые индивидуальные предприниматели осуществлять не могут. Так, Федеральным законом, регулирующим организацию страхового дела, определено, что страховщиками могут быть юридические лица, получившие лицензию для занятия страховой деятельностью. Такие же требования к организации определенной деятельности предусмотрены Федеральными законами «О банках и банковской деятельности» и «О рынке ценных бумаг».

Подытоживая вышеизложенное, первоначальное определение индивидуального предпринимателя следует дополнить фразой – гражданин, занимающийся деятельностью, не запрещенной для него законом.

На основании чего действует ИП?

Теперь разберемся, на каком основании действует ИП. При регистрации в налоговом органе физического лица в качестве ИП выдается свидетельство ИП. Для приобретения такого свидетельства гражданину следует написать заявление специального образца, предоставить паспорт и предварительно заплатить необходимый размер пошлины. Регистрация ИП происходит по месту жительства физ. лица. В Едином государственном реестре у каждого предпринимателя свой регистрационный номер (ОГРНИП). Налоговый орган присваивает ИП индивидуальный налоговый номер. Если ИП решил заниматься лицензированным видом деятельности, то для осуществления такой деятельности необходимо будет приобрести еще и лицензию.

ИП, действующий на основании свидетельства, каждую сделку с другой стороной оформляет договором. В интересах индивидуального предпринимателя заключать договор в соответствии с законодательством, что даст возможность защищать свои интересы в суде.

Запрещено законодательством заключение договора о сотрудничестве между двумя ИП.

Особенности судебной защиты прав и интересов ИП

Индивидуальный предприниматель с целью защиты своих конституционных прав и свобод может обратиться в Конституционный суд Российской Федерации. Например, о несоответствии федеральных законов или законов ее субъектов Конституции РФ, или с жалобой на должностное лицо, нарушающее права и свободы предпринимателя.

Для решения экономических споров, возникших у ИП с юридическим лицом или с государственными и другими органами, следует обращаться в арбитражный суд. Под термином «экономические споры» следует также понимать споры, которые связаны с созданием, реорганизацией или ликвидацией предприятия.

Порядок заполнения декларации по НДС для индивидуальных предпринимателей.

В каких случаях может потребоваться выписка из ЕГРИП? Как ее получить? Сколько стоит? Читайте ответы на эти и другие вопросы в нашей статье.

Если же спор между предпринимателями или предпринимателя с юридическим лицом не связан с предпринимательской деятельностью, то такие споры рассматривают суды общей юрисдикции. Например, споры могут быть связаны с брачными, семейными, жилищными или другими гражданскими отношениями. Любой спор частного предпринимателя с физическим лицом также рассматривают суды общей юрисдикции.

Вопросы правовых, экономических либо других отношений индивидуального предпринимателя, который на момент возникновения жалобы в соответствии с законодательством прекратил свою деятельность, с юридическими или иными лицами также относятся к компетенции вышеуказанных судов. Если стороной спора выступает иностранная организация, организация с иностранными инвестициями, то иск следует подавать в суды общей юрисдикции.

Порядок рассмотрения экономических споров между российским и иностранным предпринимателями изложен в двух нормативных актах одинаковой юридической силы. Из-за несогласованности законодательных актов обращение для рассмотрения таких дел возможно в Арбитражный суд или суды общей правомочности, если иное не предусмотрено международным договором или соглашением сторон.

Предприниматель по бесспорному делу может обратиться к нотариусу с письменными доказательствами юридических фактов.

В третейском суде будет рассматриваться спор ИП с любой организацией, предприятием или другим лицом по договору, в котором прописана специальная третейская оговорка или отдельным соглашением между ними будет предусмотрена передача спора в третейский суд.

Договором также можно предусмотреть урегулирование спора в досудебном порядке, который четко должен быть прописан в нем в соответствии с законодательством. Перед обращением в суд предпринимателя в таких случаях процедуру досудебного урегулирования следует обязательно соблюсти и представить суду доказательства. При отсутствии таких доказательств суд иск рассматривать не будет.

Преимущества гражданско-правового статуса индивидуального предпринимателя

Индивидуальный предприниматель, действующий на основании свидетельства ИП, имеет значительные преимущества как перед физическими, так и перед юридическими лицами. В первую очередь простота регистрации ИП является главным его преимуществом.

В финансовом плане регистрация в конечном итоге существенно не увеличит расходы физ. лица. Печать индивидуальному предпринимателю иметь необязательно, равно как и устав субъекта хозяйствования. Оформлять перечисление налогов можно через кассу отделения Сбербанка.

Ликвидация ИП, так же как и регистрация, много времени не займет. Достаточно оформить заявление установленной формы и зарегистрировать его в органах налоговой службы. При отсутствии задолженности в бюджет процедура ликвидации ИП упрощается. Заявлением оформляется и приостановка предпринимательской деятельности.

Не знаете, как закрыть ИП? Пошаговая инструкция с комментариями.

В каких случаях индивидуальному предпринимателю может пригодиться цифровая подпись? О том, что такое ЭЦП и как ее получить, читайте в нашей статье.

Быстрый способ получить информацию о предпринимателе зная его ИНН: http://svoy-business.com/organizatsiya-biznesa/dokumentatsiya/kak-proverit-ip-po-inn.html

Налогообложение для ИП более щадящее, чем для юридических лиц. С июня 2014 года для них действует новый порядок учета кассовых операций. Порядок предусматривает право на не установление лимита наличных денег в кассе. В связи с новыми правилами, необходимо будет завести новую кассовую книгу и обзавестись новыми бланками расходных и приходных кассовых ордеров.

Особенность статуса индивидуального предпринимателя заключается еще и в том, что в отличие от физ. лица ИП может получать легально доход от осуществляемой им деятельности на постоянной основе. При этом гражданско-правовое положение индивидуального предпринимателя законодательно защищено государством.

Отрицательные особенности правового статуса индивидуального предпринимателя?

К недостаткам можно отнести тот факт, что ИП как должник может потерять все свое имущество, в том числе и личное, нажитое в браке. Исключением может быть имущество, предусмотренное в брачном контракте как личное имущество второй половины (супруга или супруги). Также не может быть взыскано имущество, которое указано в статье 24 ГК РФ и в статье 446 ГКП РФ.

Не все крупные бизнесмены хотят иметь дело с ИП. Это может быть связано с его системой налогообложения, поскольку упрощенцы не являются плательщиками НДС. А переплачивать сумму НДС не всем предприятиям рентабельно.

Свое дело ИП продать не может, может продать только имущество.

Резюме

Доля малого бизнеса в структуре ВВП России составляет около 20%, в которой большую часть составляют ИП. Причина слабого развития ИП – это недостаточное внимание со стороны государства к нуждам малого бизнеса. Вместе с тем, такие предприятия являются более гибкими и приспособленными к изменяющимся требованиям рынка.

Похожие статьи

Помогла статья? Подписывайтесь в наши сообщества: ВКонтакте, Фейсбуке, Twitter, Одноклассниках или Google Plus.

Будем очень благодарны, если поставите «Лайк» ниже. Спасибо!

Получайте обновления прямо на вашу почту:

Назначение, особенности и сравнение директора ИП с ООО


ИП заслуженно считается одним из самых востребованных форматов ведения бизнеса в России. Главные причины его популярности очевидны и состоят в упрощенной процедуре регистрации и минимальных требованиях к ведению бухгалтерского учета. Вместе с тем ИП наделен многими функциями, характерными для ООО, например, возможностью приема на работу наемных сотрудников. Логичным следствием этого становится вопрос, может ли индивидуальный предприниматель нанимать директора.

Особенности правового статуса ИП в отношении наемных сотрудников


Статус индивидуального предпринимателя не предполагает осуществление трудовой деятельности. Поэтому ИП не имеет права заключать трудовой договор с самим собой. Как следствие – предприниматель не может назначить себя на какую-либо должность, включая директорскую.


В тоже время ничего не препятствует его участию в работе и даже руководстве других хозяйствующих субъектов, например, ООО. ИП имеет вполне законную возможность возглавлять любую организацию, в том числе – занимая должность директора – генерального, исполнительного и т.д.


Таким образом, можно выделить три главных особенности ИП в отношении найма работников:

  • предпринимателю разрешается нанимать сотрудников, но не лично себя;
  • предприниматель не может вносить в собственную трудовую книжку сведения о назначении себя руководителем ИП;
  • предприниматель не имеет права выплачивать себе ЗП и назначать на какие-либо должности.

Особенности должности директора у ИП


Директорская должность ассоциируется с ООО. Это легко объяснимо, так как работа коммерческой организации невозможна без исполнительного органа управления – единоличного или коллегиального. Деятельность ИП не требует назначения руководителя, так как его функции исполняет сам предприниматель. Вместе с тем, нередко возникают ситуации, когда подобная необходимость все-таки возникает. К числу таких случаев относятся:

  • нетрудоспособность ИП – кратковременная или продолжительная – исключающая самостоятельное ведение предпринимательской деятельности;
  • расширение бизнеса и наличие нескольких самостоятельных подразделений, каждое из которых нуждается в управлении;
  • сложное семейное положение или другие личные проблемы, препятствующие полноценной работе.


В любой из перечисленных ситуаций назначение директора и делегирование ему части управленческих функций – это вполне эффективный способ решения возникшей проблемы.

Отличия директорской должности у ИП и в ООО


Несмотря на одинаковое название, директорские должности в ИП и ООО заметно отличаются. Основная разница между ними заключается в следующем:

  •  статус. Директор в ООО является полноценным руководителем, тем более – если речь идет о генеральном директоре. ИП не имеет права назначать генерального директора, так как окончательные решения принимает самостоятельно;
  • регламентирующий документ. Порядок назначения, полномочия и обязанности директора ООО определяются уставом и другой учредительной документацией. Функции директора у ИП регламентируются доверенностью, выданной предпринимателем;
  • характер деятельности. Как уже было отмечено выше, директор ООО руководит организацией. Работник на аналогичной должности в ИП фактически представляет собой менеджера, который трудится под руководством или по инструкциям предпринимателя. Он управляет отдельным участком работы или направлением бизнеса ИП.


Важно! Еще одно ключевое отличие состоит в уровне ответственности. Директор ООО отвечает за работу организации, за работу ИП в целом отвечает сам предприниматель.


С учетом перечисленных отличий в директорском статусе перечень руководящих должностей в ИП, на которые может быть назначен наемный сотрудник, выглядит следующим образом:

  • коммерческий или исполнительный директор;
  • управляющий подразделением или участком работы;
  • директор по продажам или маркетингу;
  • руководитель направления (работа с кадрами, складской учет, розничная торговля и т. д.)

Назначение директора ИП – особенности и этапы процедуры


Действующее трудовое законодательство предусматривает стандартную процедуру назначения директора ИП. Она включает следующие стадии реализации мероприятия:

  • издание приказа о назначении на должность;
  • составление должностной инструкции и ознакомление с документом кандидата в директора;
  • заключение трудового договора;
  • оформление доверенности на имя директора.


Все четыре указанных документа – приказ, должностная инструкция, трудовой договор и доверенность – оформляются в соответствии с обычными требованиями к подобной документации. Они ничем не отличаются от тех, что предъявляются в ООО. Наиболее важное из обязательных условий – наличие в тексте трудового договора нескольких обязательных разделов:

  • функции и должностные обязанности директора;
  • требования к сотруднику на директорской должности;
  • данные о внутренних правилах и трудовом распорядке;
  • ответственность работника и нанимающего его ИП;
  • величина и порядок выплаты заработной платы, премий и других стимулирующих платежей.


В качестве вывода необходимо отметить следующее. ИП имеет право назначить директора из числа наемных работников. Целью мероприятия обычно становится делегирование части полномочий. Для того, чтобы поставленная задача была решена, необходимо четко следовать положениям трудового законодательства и грамотно оформить необходимые документы.

Найти | CSRC

SP 800-82 Ред. 3

23.04.2021

Статус: черновик

Скачать: нет в наличии

Черновой вариант 23. 04.2021
SP 1800-32

22.04.2021

Статус: черновик

Черновой вариант 22.04.2021
NISTIR 8356

16.04.2021

Статус: черновик

Черновой вариант 16. 04.2021
Белая книга

12.04.2021

Статус: черновик

Черновой вариант 12.04.2021
NISTIR 8310

29.03.2021

Статус: черновик

Черновой вариант 29. 03.2021
NISTIR 8360

23.03.2021

Статус: черновик

Черновой вариант 23.03.2021
SP 1800-22

18.03.2021

Статус: черновик

Черновой вариант 18.03.2021
SP 1800-34

17.03.2021

Статус: черновик

Черновой вариант 17.03.2021
NISTIR 8355

17.03.2021

Статус: черновик

Черновой вариант 17.03.2021
Белая книга

16.03.2021

Статус: черновик

Черновой вариант 16.03.2021
Белая книга

24.02.2021

Статус: черновик

Черновой вариант 24.02.2021
NISTIR 8344

02.08.2021

Статус: черновик

Черновой вариант 02.08.2021
SP 1800-33

01.02.2021

Статус: черновик

Черновой вариант 01.02.2021
SP 800-47 Ред.1

26.01.2021

Статус: черновик

Черновой вариант 26.01.2021
SP 800-204Б

26.01.2021

Статус: черновик

Черновой вариант 26.01.2021
Белая книга

21.01.2021

Статус: черновик

Черновой вариант 21.01.2021
SP 800-213

15.12.2020

Статус: черновик

Черновой вариант 15.12.2020
NISTIR 8259C

15.12.2020

Статус: черновик

Черновой вариант 15.12.2020
NISTIR 8259B

15.12.2020

Статус: черновик

Черновой вариант 15.12.2020
NISTIR 8259D

15.12.2020

Статус: черновик

Черновой вариант 15.12.2020
NISTIR 8286A

14.12.2020

Статус: черновик

Черновой вариант 14.12.2020
NISTIR 8320A

07.12.2020

Статус: черновик

Черновой вариант 07.12.2020
SP 1800-30

16.11.2020

Статус: черновик

Черновой вариант 16.11.2020
FIPS 201-3

02.11.2020

Статус: черновик

Черновой вариант 02.11.2020
Белая книга

01.10.2020

Статус: черновик

Черновой вариант 01.10.2020
NISTIR 8235

28.09.2020

Статус: черновик

Черновой вариант 28.09.2020
SP 800-55 Ред.2

24.09.2020

Статус: черновик

Скачать: нет в наличии

Черновой вариант 24.09.2020
SP 1800-15

16.09.2020

Статус: черновик

Черновой вариант 16.09.2020
SP 1800-31

10.09.2020

Статус: черновик

Черновой вариант 10.09.2020
SP 800-46 Ред.3

10.09.2020

Статус: черновик

Скачать: нет в наличии

Черновой вариант 10.09.2020
Белая книга

09.08.2020

Статус: черновик

Черновой вариант 09.08.2020
SP 800-63-4

06.08.2020

Статус: черновик

Скачать: нет в наличии

Черновой вариант 06.08.2020
Белая книга

26.05.2020

Статус: черновик

Черновой вариант 26.05.2020
Белая книга

28.04.2020

Статус: черновик

Черновой вариант 28.04.2020
SP 1800-19

13.04.2020

Статус: черновик

Черновой вариант 13.04.2020
Белая книга

01.04.2020

Статус: черновик

Черновой вариант 01.04.2020
SP 800-124 Ред.2

24.03.2020

Статус: черновик

Черновой вариант 24.03.2020
SP 800-161 Ред.1

04.02.2020

Статус: черновик

Скачать: нет в наличии

Черновой вариант 04.02.2020
FIPS 186-5

31.10.2019

Статус: черновик

Черновой вариант 31.10.2019
SP 800–186

31.10.2019

Статус: черновик

Черновой вариант 31.10.2019
NISTIR 8269

30.10.2019

Статус: черновик

Черновой вариант 30.10.2019
Белая книга

08.10.2019

Статус: черновик

Черновой вариант 08.10.2019
NISTIR 8267

01.10.2019

Статус: черновик

Черновой вариант 01.10.2019
Белая книга

17.06.2019

Статус: черновик

Черновой вариант 17.06.2019
SP 1800-13

29.05.2019

Статус: черновик

Черновой вариант 29.05.2019
Белая книга

22.05.2019

Статус: черновик

Черновой вариант 22.05.2019
NISTIR 8213

06.05.2019

Статус: черновик

Черновой вариант 06.05.2019
SP 800-38G Ред.1

28.02.2019

Статус: черновик

Черновой вариант 28.02.2019
Белая книга

01.02.2019

Статус: черновик

Черновой вариант 01.02.2019
SP 800-179 Ред.1

19.10.2018

Статус: черновик

Черновой вариант 19.10.2018
Белая книга

17.10.2018

Статус: черновик

Черновой вариант 17.10.2018
SP 1800-18

28.09.2018

Статус: черновик

Черновой вариант 28.09.2018
SP 800-71

02.07.2018

Статус: черновик

Черновой вариант 02.07.2018
Белая книга

31.05.2018

Статус: черновик

Черновой вариант 31.05.2018
Белая книга

16.01.2018

Статус: черновик

Черновой вариант 16.01.2018
NISTIR 8193

08.11.2017

Статус: черновик

Черновой вариант 08.11.2017
Белая книга

12.10.2017

Статус: черновик

Черновой вариант 12.10.2017
SP 1800-3

20.09.2017

Статус: черновик

Черновой вариант 20.09.2017
SP 1800-9

31.08.2017

Статус: черновик

Черновой вариант 31.08.2017
NISTIR 8139

02.02.2017

Статус: черновик

Черновой вариант 02.02.2017
SP 800–188

15.12.2016

Статус: черновик

Черновой вариант 15.12.2016
NISTIR 8138

30.09.2016

Статус: черновик

Черновой вариант 30.09.2016
Белая книга

13.09.2016

Статус: черновик

Черновой вариант 13.09.2016
NISTIR 8144

12.09.2016

Статус: черновик

Черновой вариант 12.09.2016
Белая книга

09.05.2016

Статус: черновик

Черновой вариант 09.05.2016
SP 800-90C

13.04.2016

Статус: черновик

Черновой вариант 13.04.2016
SP 800-154

14.03.2016

Статус: черновик

Черновой вариант 14.03.2016
SP 800–180

18.02.2016

Статус: черновик

Черновой вариант 18.02.2016
NISTIR 8085

17.12.2015

Статус: черновик

Черновой вариант 17.12.2015
NISTIR 8058

01.05.2015

Статус: черновик

Черновой вариант 01.05.2015
NISTIR 8050

02.04.2015

Статус: черновик

Черновой вариант 02.04.2015
SP 800-85Б-4

06.08.2014

Статус: черновик

Черновой вариант 06.08.2014
NISTIR 7924

29.05.2014

Статус: черновик

Черновой вариант 29.05.2014
NISTIR 7981

07.03.2014

Статус: черновик

Черновой вариант 07.03.2014
SP 800–164

31.10.2012

Статус: черновик

Черновой вариант 31.10.2012
SP 800-94 Ред.1

25.07.2012

Статус: черновик

Черновой вариант 25.07.2012
NISTIR 7848

07.05.2012

Статус: черновик

Черновой вариант 07.05.2012
NISTIR 7800

20.01.2012

Статус: черновик

Черновой вариант 20.01.2012
NISTIR 7799

06.01.2012

Статус: черновик

Черновой вариант 06.01.2012
NISTIR 7756

06.01.2012

Статус: черновик

Черновой вариант 06.01.2012
SP 800-155

08.12.2011

Статус: черновик

Черновой вариант 08.12.2011

Выпуск 16

На пленарных заседаниях TSG # 88e, завершающихся 3 июля 2020 г., был завершен выпуск 16 с замораживанием как этапа 3, так и ASN.1 и замораживание спецификации OpenAPI утверждается.

«Описание версии 16; сводка рабочих элементов Rel-16» (TR21.916) сейчас находится в разработке, при этом менеджер рабочего плана добавляет сводные примечания для каждой из внутренних функций. Хотя подробные данные по каждой части работы (исследования, описания рабочих элементов, функции) доступны через план работы или через портал 3GPP, мы надеемся, что «начальное состояние» (состояние до запроса на изменение) функций в TR21.916 вам пригодится.

На пленарном электронном заседании TSG # 87 утверждено изменение графика Rel-16:

Ранний выпуск 16 Статус

Release 16 является основным выпуском проекта, не в последнюю очередь потому, что он завершает нашу заявку IMT-2020 — для начальной полной системы 3GPP 5G — (см. Подробности ниже).

В дополнение к этому формальному процессу, продвинулась работа по примерно 25 исследованиям Release 16 по различным темам: мультимедийная приоритетная служба, сервисы уровня приложений для всех транспортных средств (V2X), спутниковый доступ 5G, поддержка локальных сетей в 5G. , конвергенция беспроводной и проводной связи для 5G, позиционирование и определение местоположения терминалов, связь в вертикальных областях, автоматизация сети и новые методы радиосвязи.Дальнейшие изучаемые элементы включают безопасность, кодеки и потоковые сервисы, взаимодействие локальных сетей, сегментирование сети и IoT.

Технические отчеты (результат фазы исследования) также были разработаны по расширению применимости технологии 3GPP к неназемному радиодоступу (первоначально спутники, но также должны быть рассмотрены воздушные базовые станции) и морским аспектам (внутрисудовые). , судно-берег и судно-судно). Также продолжается работа над новыми функциональными возможностями PMR для LTE, улучшающими железнодорожные услуги, первоначально разработанные с использованием радиотехнологии GSM, срок службы которой приближается к концу.

Как часть версии 16, услуги MC расширены, чтобы охватить более широкий бизнес-сектор, чем первоначальные довольно узкие услуги общественной безопасности и гражданской обороны, для которых они изначально были разработаны. Если те же или аналогичные стандарты могут использоваться для коммерческих приложений (от диспетчеризации такси до управления железнодорожным движением и других сценариев вертикального сектора, которые в настоящее время исследуются), это повысит надежность этих услуг MC за счет более широкого развертывания и снижения затрат на развертывание из-за эффект масштаба — на пользу всем пользователям.

RAN усилиями не удалось избежать короткой задержки в расписании Rel-16:

В декабре 2018 года в TSG # 82 была согласована корректировка, позволяющая сдвинуть на 3 месяца функциональную заморозку (функций) и завершение ASN.1 как для версии 15, так и для версии 16:

IMT-2020 — Окончательное представление

Release 16 будет «5G phase 2» и будет завершен в июне 2020 года (TSG # 88) — см. Корректировку, указанную выше.

Оригинальное расписание:

Эта версия будет соответствовать требованиям ITU IMT-2020 к представлению и временному плану, как указано в RP-172101:

Подробная информация о рабочем плане — для соблюдения согласованного графика подачи IMT-2020:

Шаг 1. С сентября 2017 г. по декабрь 2017 г. обсуждения в RAN ITU-R Ad-Hoc

  • Калибровка для самооценки
  • Подготовить и окончательно доработать информацию о шаблоне начального описания, которая должна быть представлена ​​в ITU-R WP 5D # 29.

Шаг 2: с начала 2018 г. по сентябрь 2018 г., таргетинг на «обновление и самооценку» в сентябре 2018 г.

  • Оценка производительности в соответствии с требованиями eMBB, mMTC и URLLC и средами тестирования для функций NR и LTE.
  • Обновите шаблон описания и подготовьте шаблон соответствия в соответствии с результатами самооценки.
  • Предоставьте шаблон описания, шаблон соответствия и результаты самооценки на основе Rel-15, сентябрь 2018 г.

Шаг 3: с сентября 2018 г. по июнь 2019 г., таргетинг на «окончательную» подачу заявок — июнь 2019 г.

  • Обновление оценки производительности с учетом обновлений Rel-16 в дополнение к Rel-15
  • Шаблон описания обновления и шаблон соответствия для учета обновлений Rel-16 в дополнение к Rel-15
  • Предоставьте шаблон описания, шаблон соответствия и результаты самооценки на основе Rel-15 и Rel-16 в июне 2019 года.

Некоторые сведения о выпуске 16

Еще один способ получить подробную информацию о функциях и рабочих элементах по версии 3GPP — он-лайн в списке функций и элементов исследования.

Шаблоны IPDR / SP — Velocidata

DOCSIS 3.0:

  • DOCSIS-CMTS-CM-REG-STATUS-TYPE /
    • DOCSIS-CMTS-CM-REG-STATUS — это схема определения службы IPDR, которая определяет статус регистрации CM, воспринимаемый CMTS.
    • Элементы записи:
      • DOCSIS-CMTS: CmtsHostName
      • DOCSIS-CMTS: CmtsSysUpTime
      • DOCSIS-CMTS: CmtsMdIfName
      • DOCSIS-CMTS: CmtsMdIfIndex
      • DOCSIS-CMTS-CM-NODE-CH: CmtsMdCmSgId
      • DOCSIS-CMTS-CM-NODE-CH: CmtsRcpId
      • DOCSIS-CMTS-CM-NODE-CH: CmtsRccStatusId
      • DOCSIS-CMTS-CM-NODE-CH: CmtsRcsId
      • DOCSIS-CMTS-CM-NODE-CH: CmtsTcsId
      • DOCSIS-CM: CmMacAddr
      • DOCSIS-CM: CmIpv4Addr
      • DOCSIS-CM: CmIpv6Addr
      • DOCSIS-CM: CmIpv6LinkLocalAddr
      • DOCSIS-CM: CmQosVersion
      • DOCSIS-CM: CmRegStatusValue
      • DOCSIS-CM: CmLastRegTime
      • DOCSIS-CM: CmEnergyMgtEnabled
      • DOCSIS-CM: CmEnergyMgtOperStatus
      • DOCSIS-CM: CmEnergyMgt1x1ModeTotalDuration
      • DOCSIS-REC: RecType
      • DOCSIS-REC: RecCreationTime

• DOCSIS-CMTS-CM-SERVICE-FLOW-TYPE /

  • DOCSIS-CMTS-CM-SERVICE-FLOW — это схема определения службы IPDR, определяющая подробности потоков службы.
  • Элементы записи:
    • DOCSIS-CMTS: CmtsHostName
    • DOCSIS-CMTS: CmtsSysUpTime
    • DOCSIS-CMTS: CmtsMdIfName
    • DOCSIS-CMTS: CmtsMdIfIndex
    • DOCSIS-REC: RecType
    • DOCSIS-REC: RecCreationTime
    • DOCSIS-QOS: ServiceFlowChSet
    • DOCSIS-QOS: ServiceAppId
    • DOCSIS-QOS: ServiceDsMulticast
    • DOCSIS-QOS: ServiceIdentifier
    • DOCSIS-QOS: ServiceGateId
    • DOCSIS-QOS: ServiceClassName
    • DOCSIS-QOS: ServiceDirection
    • DOCSIS-SERVICE-FLOW: ServiceTrafficPriority
    • DOCSIS-SERVICE-FLOW: ServiceMaxSustained
    • DOCSIS-SERVICE-FLOW: ServiceMaxBurst
    • DOCSIS-SERVICE-FLOW: ServiceMinReservedRate
    • DOCSIS-SERVICE-FLOW: ServiceMinReservedPktSize
    • DOCSIS-SERVICE-FLOW: ServiceIpTos
    • DOCSIS-SERVICE-FLOW: ServicePeakRate
    • DOCSIS-SERVICE-FLOW: График обслуживания
    • DOCSIS-SERVICE-FLOW: ServiceNomPollInterval
    • DOCSIS-SERVICE-FLOW: ServiceTolPollJitter
    • DOCSIS-SERVICE-FLOW: ServiceUGSize
    • DOCSIS-SERVICE-FLOW: ServiceNomGrantInterval
    • DOCSIS-SERVICE-FLOW: ServiceTolGrantJitter
    • DOCSIS-SERVICE-FLOW: ServiceGrantsPerInterval
    • DOCSIS-SERVICE-FLOW: ServicePacketClassifiers
    • DOCSIS-QOS: ServiceTimeCreated

• DOCSIS-CMTS-CM-US-STATS-TYPE /

  • DOCSIS-CMTS-CM-US-STATS — это схема определения службы IPDR, которая определяет статистику восходящего канала.Это определение поддерживает несколько восходящих каналов.
  • Элементы записи:
    • DOCSIS-CMTS: CmtsHostName
    • DOCSIS-CMTS: CmtsSysUpTime
    • DOCSIS-CMTS: CmtsMdIfName
    • DOCSIS-CMTS: CmtsMdIfIndex
    • DOCSIS-CM: CmMacAddr
    • DOCSIS-CM: CmRegStatusId
    • DOCSIS-CMTS-CM-US: CmtsCmUsChIfName
    • DOCSIS-CMTS-CM-US: CmtsCmUsChIfIndex
    • DOCSIS-CMTS-CM-US: CmtsCmUsChId
    • DOCSIS-CMTS-CM-US: CmtsCmUsModulationType
    • DOCSIS-CMTS-CM-US: CmtsCmUsRxPower
    • DOCSIS-CMTS-CM-US: CmtsCmUsSignalNoise
    • DOCSIS-CMTS-CM-US: CmtsCmUsMicroreflections
    • DOCSIS-CMTS-CM-US: CmtsCmUsEqData
    • DOCSIS-CMTS-CM-US: CmtsCmUsUnerroreds
    • DOCSIS-CMTS-CM-US: CmtsCmUsCorrecteds
    • DOCSIS-CMTS-CM-US: CmtsCmUsUncorrectables
    • DOCSIS-CMTS-CM-US: CmtsCmUsHighResolutionTimingOffset
    • DOCSIS-CMTS-CM-US: CmtsCmUsIsMuted
    • DOCSIS-CMTS-CM-US: CmtsCmUsRangingStatus
    • DOCSIS-REC: RecType
  • DOCSIS-CMTS-DS-UTIL-STATS-TYPE /
    • DOCSIS-CMTS-DS-UTIL-STATS-TYPE — это схема определения услуги IPDR, которая определяет статистику использования нисходящего потока для указанного нисходящего интерфейса для указанной CMTS.
    • Элементы записи:
      • DOCSIS-CMTS: CmtsHostName
      • DOCSIS-CMTS: CmtsSysUpTime
      • DOCSIS-CMTS: CmtsMdIfIndex
      • DOCSIS-CMTS-DS-UTIL: DsIfIndex
      • DOCSIS-CMTS-DS-UTIL: DsIfName
      • DOCSIS-CMTS-DS-UTIL: DsChId
      • DOCSIS-CMTS-DS-UTIL: DsUtilInterval
      • DOCSIS-CMTS-DS-UTIL: DsUtilIndexPercentage
      • DOCSIS-CMTS-DS-UTIL: DsUtilTotalBytes
      • DOCSIS-CMTS-DS-UTIL: DsUtilUsedBytes
      • DOCSIS-REC: RecType

• DOCSIS-CMTS-TOPOLOGY-TYPE /

  • DOCSIS-CMTS-TOPOLOGY-TYPE — это схема определения службы IPDR, которая определяет информацию о топологии RF, которая показывает возможности подключения нисходящих и восходящих каналов к оптоволоконным узлам в CMTS.
  • Элементы записи:
    • DOCSIS-CMTS: CmtsHostName
    • DOCSIS-CMTS: CmtsSysUpTime
    • DOCSIS-CMTS: CmtsIpv4Addr
    • DOCSIS-CMTS: CmtsIpv6Addr
    • DOCSIS-CMTS: CmtsMdIfName
    • DOCSIS-CMTS: CmtsMdIfIndex
    • DOCSIS-MD-NODE: CmtsNodeName
    • DOCSIS-MD-NODE: CmtsMdCmSgId
    • DOCSIS-MD-NODE: CmtsMdDsSgId
    • DOCSIS-MD-NODE: CmtsMdUsSgId
    • DOCSIS-MD-NODE: CmtsMdDsSgChList
    • DOCSIS-MD-NODE: CmtsMdUsSgChList
    • DOCSIS-REC: RecType

• DOCSIS-CMTS-US-UTIL-STATS-TYPE /

  • DOCSIS-CMTS-US-UTIL-STATS-TYPE — это схема определения службы IPDR, которая определяет статистику использования восходящего потока для указанного восходящего интерфейса логического канала для указанной CMTS.
  • Элементы записи:
    • DOCSIS-CMTS: CmtsHostName
    • DOCSIS-CMTS: CmtsSysUpTime
    • DOCSIS-CMTS: CmtsMdIfIndex
    • DOCSIS-CMTS-US-UTIL: UsIfIndex
    • DOCSIS-CMTS-US-UTIL: UsIfName
    • DOCSIS-CMTS-US-UTIL: UsChId
    • DOCSIS-CMTS-US-UTIL: UsUtilInterval
    • DOCSIS-CMTS-US-UTIL: UsUtilIndexPercentage
    • DOCSIS-CMTS-US-UTIL: UsUtilTotalMslots
    • DOCSIS-CMTS-US-UTIL: UsUtilUcastGrantedMslots
    • DOCSIS-CMTS-US-UTIL: UsUtilTotalCntnMslots
    • DOCSIS-CMTS-US-UTIL: UsUtilUsedCntnMslots
    • DOCSIS-CMTS-US-UTIL: UsUtilCollCntnMslots
    • DOCSIS-CMTS-US-UTIL: UsUtilTotalCntnReqMslots
    • DOCSIS-CMTS-US-UTIL: UsUtilUsedCntnReqMslots
    • DOCSIS-CMTS-US-UTIL: UsUtilCollCntnReqMslots
    • DOCSIS-CMTS-US-UTIL: UsUtilTotalCntnReqDataMslots
    • DOCSIS-CMTS-US-UTIL: UsUtilUsedCntnReqDataMslots
    • DOCSIS-CMTS-US-UTIL: UsUtilCollCntnReqDataMslots
    • DOCSIS-CMTS-US-UTIL: UsUtilTotalCntnInitMaintMslots
    • DOCSIS-CMTS-US-UTIL: UsUtilUsedCntnInitMaintMslots
    • DOCSIS-CMTS-US-UTIL: UsUtilCollCntnInitMaintMslots
    • DOCSIS-REC: RecType
  • DOCSIS-CPE-TYPE /
    • DOCSIS-CPE-TYPE — это схема определения услуги IPDR, определяющая запись данных IPDR типа оборудования клиента (CPE).
    • Элементы записи:
      • DOCSIS-CMTS: CmtsHostName
      • DOCSIS-CMTS: CmtsSysUpTime
      • DOCSIS-CMTS: CmtsMdIfName
      • DOCSIS-CMTS: CmtsMdIfIndex
      • DOCSIS-CM: CmMacAddr
      • DOCSIS-REC: RecType
      • DOCSIS-CPE: CpeMacAddr
      • DOCSIS-CPE: CpeIpv4AddrList
      • DOCSIS-CPE: CpeIpv6AddrList
      • DOCSIS-CPE: CpeFqdn
  • DOCSIS-DIAG-LOG-DETAIL-TYPE /
    • DOCSIS-DIAG-LOG-DETAIL-TYPE — это схема определения службы IPDR, определяющая запись данных IPDR типа подробных сведений журнала диагностики CMTS.Запись IPDR, содержащая одну подробную запись журнала диагностики, представляющую одиночный кабельный модем, который вызвал по крайней мере один из диагностических триггеров.
    • Элементы записи:
      • DOCSIS-CMTS: CmtsHostName
      • DOCSIS-CM: CmMacAddr
      • DOCSIS-DIAG-LOG-DETAIL: TypeValue
      • DOCSIS-DIAG-LOG-DETAIL: граф
      • DOCSIS-DIAG-LOG-DETAIL: LastUpdate
      • DOCSIS-DIAG-LOG-DETAIL: LastErrorText
      • DOCSIS-REC: RecType
  • DOCSIS-DIAG-LOG-EVENT-TYPE /
    • DOCSIS-DIAG-LOG-EVENT-TYPE — это схема определения службы IPDR, определяющая запись данных IPDR типа события журнала диагностики CMTS.Запись IPDR на основе событий, содержащая только необходимые элементы для обновления журнала диагностики, расположенного за пределами экспортера.
    • Элементы записи:
      • DOCSIS-CMTS: CmtsHostName
      • DOCSIS-CM: CmMacAddr
      • DOCSIS-CMTS: CmtsSysUpTime
      • DOCSIS-DIAG-LOG: TriggerFlagValue
      • DOCSIS-DIAG-LOG-DETAIL: TypeValue
      • DOCSIS-DIAG-LOG-DETAIL: LastErrorText
      • DOCSIS-REC: RecType
  • DOCSIS-DIAG-LOG-TYPE /
    • Запись IPDR, содержащая одну диагностическую запись журнала, представляющую одиночный кабельный модем, который вызвал по крайней мере один из диагностических триггеров.
    • Элементы записи:
      • DOCSIS-CMTS: CmtsHostName
      • DOCSIS-CM: CmMacAddr
      • DOCSIS-DIAG-LOG: LastUpdateTime
      • DOCSIS-DIAG-LOG: CreateTime
      • DOCSIS-DIAG-LOG: LastRegTime
      • DOCSIS-DIAG-LOG: RegCount
      • DOCSIS-DIAG-LOG: RangingRetryCount
      • DOCSIS-REC: RecType
  • DOCSIS-IP-MULTICAST-STATS-TYPE /
    • DOCSIS-IP-MULTICAST-STATS-TYPE — это схема определения службы IPDR, определяющая конкретную (S, G) запись данных IPDR статистики сеанса многоадресной IP-рассылки, которая ссылается на импортированные глобальные элементы.
    • Элементы записи:
      • DOCSIS-CMTS: CmtsHostName
      • DOCSIS-CMTS: CmtsMdIfIndex
      • DOCSIS-CM: CmMacAddr
      • DOCSIS-REC: RecType
      • DOCSIS-REC: RecCreationTime
      • DOCSIS-IP-MULTICAST: IpMcastSrcIpv4Addr
      • DOCSIS-IP-MULTICAST: IpMcastSrcIpv6Addr
      • DOCSIS-IP-MULTICAST: IpMcastGrpIpv4Addr
      • DOCSIS-IP-MULTICAST: IpMcastGrpIpv6Addr
      • DOCSIS-IP-MULTICAST: IpMcastGsfId
      • DOCSIS-IP-MULTICAST: IpMcastDsid
      • DOCSIS-IP-MULTICAST: тип IpMcastSessionProtocolType
      • DOCSIS-IP-MULTICAST: IpMcastCpeMacAddrList
      • DOCSIS-IP-MULTICAST: IpMcastJoinTime
      • DOCSIS-IP-MULTICAST: IpMcastLeaveTime

• DOCSIS-SAMIS-TYPE-1/

  • DOCSIS-SAMIS-TYPE-1 — это схема определения услуги IPDR, определяющая запись данных IPDR типа 1 управления учетной записью абонента (SAMIS).SAMIS-TYPE-1 основан на модели инклюзивной потоковой передачи, в которой все поля включены в каждую потоковую запись.
  • Элементы записи:
    • DOCSIS-CMTS: CmtsHostName
    • DOCSIS-CMTS: CmtsSysUpTime
    • DOCSIS-CMTS: CmtsIpv4Addr
    • DOCSIS-CMTS: CmtsIpv6Addr
    • DOCSIS-CMTS: CmtsMdIfName
    • DOCSIS-CMTS: CmtsMdIfIndex
    • DOCSIS-CM: CmMacAddr
    • DOCSIS-CM: CmIpv4Addr
    • DOCSIS-CM: CmIpv6Addr
    • DOCSIS-CM: CmIpv6LinkLocalAddr
    • DOCSIS-CM: CmQosVersion
    • DOCSIS-CM: CmRegStatusValue
    • DOCSIS-CM: CmLastRegTime
    • DOCSIS-REC: RecType
    • DOCSIS-REC: RecCreationTime
    • DOCSIS-QOS: ServiceFlowChSet
    • DOCSIS-QOS: ServiceAppId
    • DOCSIS-QOS: ServiceDsMulticast
    • DOCSIS-QOS: ServiceIdentifier
    • DOCSIS-QOS: ServiceGateId
    • DOCSIS-QOS: ServiceClassName
    • DOCSIS-QOS: ServiceDirection
    • DOCSIS-QOS: ServiceOctetsPassed
    • DOCSIS-QOS: ServicePktsPassed
    • DOCSIS-QOS: ServiceSlaDropPkts
    • DOCSIS-QOS: ServiceSlaDelayPkts
    • DOCSIS-QOS: ServiceTimeCreated
    • DOCSIS-QOS: ServiceTimeActive

• DOCSIS-SAMIS-TYPE-2/

  • DOCSIS-SAMIS-TYPE-2 — это схема определения услуги IPDR, определяющая запись данных IPDR типа 2 управления учетными записями абонентов (SAMIS), которая ссылается на импортированные глобальные элементы.SAMIS-TYPE-2 основан на оптимизированной потоковой модели, в которой в каждую потоковую запись включаются только обновленные поля.
  • Элементы записи
    • DOCSIS-CMTS: CmtsHostName
    • DOCSIS-CMTS: CmtsSysUpTime
    • DOCSIS-CMTS: CmtsMdIfName
    • DOCSIS-CMTS: CmtsMdIfIndex
    • DOCSIS-CM: CmMacAddr
    • DOCSIS-REC: RecType
    • DOCSIS-REC: RecCreationTime
    • DOCSIS-QOS: ServiceFlowChSet
    • DOCSIS-QOS: ServiceAppId
    • DOCSIS-QOS: ServiceDsMulticast
    • DOCSIS-QOS: ServiceIdentifier
    • DOCSIS-QOS: ServiceGateId
    • DOCSIS-QOS: ServiceClassName
    • DOCSIS-QOS: ServiceDirection
    • DOCSIS-QOS: ServiceOctetsPassed
    • DOCSIS-QOS: ServicePktsPassed
    • DOCSIS-QOS: ServiceSlaDropPkts
    • DOCSIS-QOS: ServiceSlaDelayPkts
    • DOCSIS-QOS: ServiceTimeCreated
    • DOCSIS-QOS: ServiceTimeActive
  • DOCSIS-SPECTRUM-MEASUREMENT-TYPE /
    • DOCSIS-SPECTRUM-MEASUREMENT-TYPE — это схема определения услуги IPDR, определяющая запись данных IPDR типа измерения спектра расширенного контроля качества сигнала.
    • Элементы записи:
      • DOCSIS-CMTS: CmtsHostName
      • DOCSIS-CMTS: CmtsSysUpTime
      • DOCSIS-CMTS: CmtsMdIfIndex
      • ДОКУМЕНТ-СПЕКТР: SpectrumAnalysisMeasIfIndex
      • ДОКУМЕНТ-СПЕКТР: ID ребенка
      • ДОКУМЕНТ-СПЕКТР: SpectrumAnalysisMeasChCenterFreq
      • ДОКУМЕНТ-СПЕКТР: SpectrumAnalysisMeasFreqSpan
      • ДОКУМЕНТ-СПЕКТР: SpectrumAnalysisMeasNumOfBins
      • ДОКУМЕНТ-СПЕКТР: SpectrumAnalysisMeasResolutionBW
      • ДОКУМЕНТ-СПЕКТР: SpectrumAnalysisMeasBinSpacing
      • ДОКУМЕНТ-СПЕКТР: SpectrumAnalysisMeasAmplitude

DOCSIS 3.1:

  • DOCSIS-CMTS-CM-DS-OFDM-PROFILE-STATUS-TYPE /
    • DOCSIS-CMTS-CM-DS-OFDM-STATUS — это схема определения услуги IPDR, которая предоставляет данные о статусе профилей нисходящего канала OFDM каждого CM. Это определение поддерживает несколько нисходящих каналов и профилей OFDM для каждого CM. Каждая запись IPDR содержит данные состояния для одного профиля одного нисходящего канала OFDM данного CM.
    • Элементы записи:
      • DOCSIS-CMTS: CmtsHostName
      • DOCSIS-CM: CmMacAddr
      • DOCSIS-CMTS-DS-UTIL: DsIfIndex
      • DOCSIS-OFDM-PROFILE: ProfileId
      • DOCSIS-CMTS-CM-PARTIAL: PartialChanReasonCode
      • DOCSIS-CMTS-CM-PARTIAL: LastPartialChanTime
      • DOCSIS-CMTS-CM-PARTIAL: LastPartialChanReasonCode
      • DOCSIS-REC: RecType
      • DOCSIS-REC: RecCreationTime
  • DOCSIS-CMTS-CM-DS-OFDM-STATUS-TYPE /
    • DOCSIS-CMTS-CM-DS-OFDM-STATUS — это схема определения услуги IPDR для контроля состояния канала нисходящего потока OFDM CM, воспринимаемого CMTS.Каждая запись IPDR содержит один экземпляр статуса нисходящего потока OFDM для одиночного кабельного модема.
    • Элементы записи:
      • DOCSIS-CMTS: CmtsHostName
      • DOCSIS-CM: CmMacAddr
      • DOCSIS-CMTS-DS-UTIL: DsIfIndex
      • DOCSIS-CM: CmLastRegTime
      • DOCSIS-CMTS-CM-PARTIAL: CurPartialSvcReasonCode
      • DOCSIS-CMTS-CM-PARTIAL: LastPartialSvcTime
      • DOCSIS-CMTS-CM-PARTIAL: LastPartialSvcReasonCode
      • DOCSIS-CMTS-CM-PARTIAL: NumPartialSvcIncidents
      • DOCSIS-CMTS-CM-PARTIAL: NumPartialChanIncidents
      • DOCSIS-REC: RecType
      • DOCSIS-REC: RecCreationTime

• DOCSIS-CMTS-CM-REG-STATUS-TYPE /

  • DOCSIS-CMTS-CM-REG-STATUS — это схема определения службы IPDR, которая определяет статус регистрации CM, воспринимаемый CMTS.Каждая запись IPDR содержит один экземпляр статуса регистрации CM, представляющий один кабельный модем, зарегистрированный в CMTS.
  • Элементы записи:
    • DOCSIS-CMTS: CmtsHostName
    • DOCSIS-CMTS: CmtsSysUpTime
    • DOCSIS-CMTS: CmtsMdIfName
    • DOCSIS-CMTS: CmtsMdIfIndex
    • DOCSIS-CMTS-CM-NODE-CH: CmtsMdCmSgId
    • DOCSIS-CMTS-CM-NODE-CH: CmtsRcpId
    • DOCSIS-CMTS-CM-NODE-CH: CmtsRccStatusId
    • DOCSIS-CMTS-CM-NODE-CH: CmtsRcsId
    • DOCSIS-CMTS-CM-NODE-CH: CmtsTcsId
    • DOCSIS-CM: CmMacAddr
    • DOCSIS-CM: CmIpv4Addr
    • DOCSIS-CM: CmIpv6Addr
    • DOCSIS-CM: CmIpv6LinkLocalAddr
    • DOCSIS-CM: CmQosVersion
    • DOCSIS-CM: CmRegStatusValue
    • DOCSIS-CM: CmLastRegTime
    • DOCSIS-CM: CmEnergyMgtEnabled
    • DOCSIS-CM: CmEnergyMgtOperStatus
    • DOCSIS-OFDM-ПРОФИЛЬ: DsProfileIdList
    • DOCSIS-OFDM-ПРОФИЛЬ: UsProfileIucList
    • DOCSIS-CMTS-CM-DS-OFDM: TcsPhigh
    • DOCSIS-CMTS-CM-DS-OFDM: TcsDrwTop
    • DOCSIS-CMTS-CM-DS-OFDM: MinUsableDsFreq
    • DOCSIS-CMTS-CM-DS-OFDM: MaxUsableDsFreq
    • DOCSIS-CMTS-CM-US-OFDMA: MaxUsableUsFreq
    • DOCSIS-CMTS-CM-PARTIAL: PartialSvcState
    • DOCSIS-CMTS-CM-PARTIAL: PartialChanState
    • DOCSIS-REC: RecType
    • DOCSIS-REC: RecCreationTime

• DOCSIS-CMTS-CM-SERVICE-FLOW-TYPE /

  • DOCSIS-CMTS-CM-SERVICE-FLOW — это схема определения службы IPDR, определяющая подробности потоков службы.
  • Элементы записи:
    • DOCSIS-CMTS: CmtsHostName
    • DOCSIS-CMTS: CmtsSysUpTime
    • DOCSIS-CMTS: CmtsMdIfName
    • DOCSIS-CMTS: CmtsMdIfIndex
    • DOCSIS-REC: RecType
    • DOCSIS-REC: RecCreationTime
    • DOCSIS-QOS: ServiceFlowChSet
    • DOCSIS-QOS: ServiceAppId
    • DOCSIS-QOS: ServiceDsMulticast
    • DOCSIS-QOS: ServiceIdentifier
    • DOCSIS-QOS: ServiceGateId
    • DOCSIS-QOS: ServiceClassName
    • DOCSIS-QOS: ServiceDirection
    • DOCSIS-SERVICE-FLOW: ServiceTrafficPriority
    • DOCSIS-SERVICE-FLOW: ServiceMaxSustained
    • DOCSIS-SERVICE-FLOW: ServiceMaxBurst
    • DOCSIS-SERVICE-FLOW: ServiceMinReservedRate
    • DOCSIS-SERVICE-FLOW: ServiceMinReservedPktSize
    • DOCSIS-SERVICE-FLOW: ServiceIpTos
    • DOCSIS-SERVICE-FLOW: ServicePeakRate
    • DOCSIS-SERVICE-FLOW: График обслуживания
    • DOCSIS-SERVICE-FLOW: ServiceNomPollInterval
    • DOCSIS-SERVICE-FLOW: ServiceTolPollJitter
    • DOCSIS-SERVICE-FLOW: ServiceUGSize
    • DOCSIS-SERVICE-FLOW: ServiceNomGrantInterval
    • DOCSIS-SERVICE-FLOW: ServiceTolGrantJitter
    • DOCSIS-SERVICE-FLOW: ServiceGrantsPerInterval
    • DOCSIS-SERVICE-FLOW: ServicePacketClassifiers
    • DOCSIS-QOS: ServiceTimeCreated

• DOCSIS-CMTS-CM-US-OFDMA-PROFILE-STATUS-TYPE /

  • DOCSIS-CMTS-CM-US-OFDMA-STATUS — это схема определения услуги IPDR, которая предоставляет данные о состоянии профилей восходящего канала OFDMA каждого CM.Это определение поддерживает несколько восходящих каналов и профилей OFDMA для каждого CM. Каждая запись IPDR содержит данные состояния для одного профиля / данных IUC одного восходящего канала OFDMA данного CM.
  • Элементы записи:
    • DOCSIS-CMTS: CmtsHostName
    • DOCSIS-CM: CmMacAddr
    • DOCSIS-CMTS-CM-US: CmtsCmUsChIfIndex
    • DOCSIS-OFDM-ПРОФИЛЬ: DataIuc
    • DOCSIS-OFDM-PROFILE: TotalCodewords
    • DOCSIS-OFDM-PROFILE: CorrectedCodewords
    • DOCSIS-OFDM-PROFILE: UnreliableCodewords
    • DOCSIS-OFDM-PROFILE: ProfileCounterDiscontinuityTime
    • DOCSIS-CMTS-CM-PARTIAL: PartialChanReasonCode
    • DOCSIS-CMTS-CM-PARTIAL: LastPartialChanTime
    • DOCSIS-CMTS-CM-PARTIAL: LastPartialChanReasonCode
    • DOCSIS-REC: RecCreationTime
    • DOCSIS-REC: RecType

• DOCSIS-CMTS-CM-US-OFDMA-STATUS-TYPE /

  • DOCSIS-CMTS-CM-US-OFDMA-STATUS — это схема определения услуги IPDR для мониторинга состояния восходящего канала OFDMA CM, воспринимаемого CMTS.Каждая запись IPDR содержит один экземпляр статуса восходящего потока OFDMA одного кабельного модема.
  • Элементы записи:
    • DOCSIS-CMTS: CmtsHostName
    • DOCSIS-CM: CmMacAddr
    • DOCSIS-CMTS-CM-US: CmtsCmUsChIfIndex
    • DOCSIS-CM: CmLastRegTime
    • DOCSIS-CMTS-CM-US-OFDMA: RxPower
    • DOCSIS-CMTS-CM-US-OFDMA: MeanRxMer
    • DOCSIS-CMTS-CM-US-OFDMA: StdDevRxMer
    • DOCSIS-CMTS-CM-US-OFDMA: RxMerThreshold
    • DOCSIS-CMTS-CM-US-OFDMA: ThresholdRxMerValue
    • DOCSIS-CMTS-CM-US-OFDMA: ThresholdRxMerHighestFreq
    • DOCSIS-CMTS-CM-US: CmtsCmUsMicroreflections
    • DOCSIS-CMTS-CM-US: CmtsCmUsHighResolutionTimingOffset
    • DOCSIS-CMTS-CM-US: CmtsCmUsIsMuted
    • DOCSIS-CMTS-CM-US: CmtsCmUsRangingStatus
    • DOCSIS-CMTS-CM-PARTIAL: CurPartialSvcReasonCode
    • DOCSIS-CMTS-CM-PARTIAL: LastPartialSvcTime
    • DOCSIS-CMTS-CM-PARTIAL: LastPartialSvcReasonCode
    • DOCSIS-CMTS-CM-PARTIAL: NumPartialSvcIncidents
    • DOCSIS-CMTS-CM-PARTIAL: NumPartialChanIncidents
    • DOCSIS-REC: RecType
    • DOCSIS-REC: RecCreationTime

• DOCSIS-DS-OFDM-PROFILE-STATS-TYPE /

  • DOCSIS-DS-OFDM-PROFILE-STATS — это схема определения службы IPDR, которая предоставляет статистику по профилям нисходящего потока OFDM.Это определение поддерживает несколько нисходящих каналов и профилей OFDM. Каждая запись IPDR содержит статистику для одного профиля DS для одного канала OFDM DS.
  • Элементы записи:
    • DOCSIS-CMTS: CmtsHostName
    • DOCSIS-CMTS-DS-UTIL: DsIfIndex
    • DOCSIS-OFDM-PROFILE: ProfileId
    • DOCSIS-OFDM-ПРОФИЛЬ: FullChannelSpeed ​​
    • DOCSIS-OFDM-ПРОФИЛЬ: OutOctets
    • DOCSIS-OFDM-ПРОФИЛЬ: OutUnicastOctets
    • DOCSIS-OFDM-PROFILE: OutMulticastOctets
    • DOCSIS-OFDM-ПРОФИЛЬ: OutFrames
    • DOCSIS-OFDM-ПРОФИЛЬ: OutUnicastFrames
    • DOCSIS-OFDM-ПРОФИЛЬ: OutMulticastFrames
    • DOCSIS-OFDM-PROFILE: CounterDiscontinuityTime
    • DOCSIS-REC: RecType
    • DOCSIS-REC: RecCreationTime
  • DOCSIS-US-OFDMA-PROFILE-STATS-TYPE /
    • DOCSIS-US-OFDMA-PROFILE-STATS — это схема определения службы IPDR, которая предоставляет статистику по профилям восходящего потока OFDMA.Это определение поддерживает несколько восходящих каналов и профилей OFDMA. Каждая запись IPDR содержит статистику для одного восходящего профиля / IUC данных для одного канала OFDMA в США.
    • Элементы записи:
      • DOCSIS-CMTS: CmtsHostName
      • DOCSIS-CMTS-CM-US: CmtsCmUsChIfIndex
      • DOCSIS-OFDM-ПРОФИЛЬ: DataIuc
      • DOCSIS-OFDM-PROFILE: TotalCodewords
      • DOCSIS-OFDM-PROFILE: CorrectedCodewords
      • DOCSIS-OFDM-PROFILE: UnreliableCodewords
      • DOCSIS-OFDM-ПРОФИЛЬ: InOctets
      • DOCSIS-OFDM-PROFILE: CounterDiscontinuityTime
      • DOCSIS-REC: RecType
      • DOCSIS-REC: RecCreationTime

NJ MVC | Таблички с символами инвалидных колясок и таблички для лиц с ограниченными возможностями

Общая информация

Лица, отвечающие медицинским требованиям, могут выбрать один из трех вариантов:

  • Один (1) набор номерных знаков с символом инвалидной коляски
  • Один (1) человек с табличкой инвалидности
  • Один (1) набор табличек и одна табличка

Квалифицированные кандидаты получают один комплект номерных знаков с символом инвалидной коляски для транспортного средства, зарегистрированного либо на квалифицированное лицо с ограниченными возможностями, либо на одного члена семьи, который предоставляет квалифицированному лицу транспорт (также известный как
Водитель).См. Страницу квалификаций для получения подробной информации.

Табличка «Лица с инвалидностью» разрешает водителю парковать любое транспортное средство на парковочном месте с символом инвалидной коляски при условии, что квалифицированное лицо, указанное для лица с удостоверением личности с ограниченными возможностями, находится в транспортном средстве и имеет при себе его удостоверение личности.

Лицо, имеющее удостоверение личности с инвалидностью, должно постоянно находиться в транспортном средстве или с водителем в качестве доказательства инвалидности.Карта не подлежит передаче другому лицу и должна быть на физическом лице.
всегда пользоваться привилегиями парковки с символом инвалидной коляски. Любое злоупотребление или неправильное использование этой привилегии приведет к немедленному аннулированию удостоверения личности, таблички и табличек.

В соответствии с законодательством штата Нью-Джерси (N.J.S.A. 2C: 21-4a) ложное заявление или предоставление дезинформации в заявке на получение или облегчение получения номерных знаков или табличек для лиц с ограниченными возможностями является четвертой степенью
преступление, и лицо, которое было осуждено за преступление, может быть подвергнуто выплате штрафа, размер которого не превышает 10 000 долларов США, и тюремному заключению на срок до 18 месяцев.

Лицам с ограниченными возможностями парковочные привилегии действительны в течение трех лет, после чего необходимо подать новое заявление и справку от утвержденного практикующего врача.

Как обращаться

Чтобы подать заявку на номерные знаки или табличку, заполните Заявление на получение номерных знаков транспортного средства и / или таблички для лиц с ограниченными возможностями (форма SP-41). Плата ни за одну лицензию не взимается.
тарелки или табло.

Эту транзакцию можно совершить, посетив агентство по продаже автомобилей или отправив запрос по почте. Если вы решите отправить по почте, отправьте на:

Комиссия по автотранспортным средствам Нью-Джерси
Специальная табличка
225 East State Street
PO Box 015
Трентон, Нью-Джерси 08666-0015

Копия регистрации транспортного средства должна быть приложена к заявке на номер.

Кандидаты без водительских прав или идентификационной карты (ID), не являющейся водителем, должны подтвердить свою личность, выполнив требования проверки 6 Points of ID .

Примечание. Таблички с символом инвалидной коляски не могут быть выданы для транспортных средств, принадлежащих компаниям, организациям или группам или сданным в аренду.

Контрольный список инструкций (форма SP-41A) доступен, чтобы убедиться, что у вас есть вся необходимая информация для полного заполнения заявки и избежания задержек в обработке.

Как повторно сертифицировать и продлить

Как обновить номерные знаки с символом инвалидной коляски

Вы должны ежегодно обновлять номерные знаки с символом инвалидной коляски в рамках процесса продления в масштабе штата. Каждые три года, начиная с 1 августа 2013 года, будет требоваться повторная медицинская аттестация для продления лицензии с символом инвалидной коляски.
тарелки.

Если вы больше не имеете права на получение номеров, вы должны сдать таблички с символом инвалидной коляски и лицо с удостоверением личности и подать заявление на получение нового набора обычных номерных знаков в автотранспортном агентстве.

Как обновить таблички инвалидам

Каждые три года вы должны повторно подтверждать свое медицинское состояние. Вы можете обновить свой табло, отправив заявление на повторную сертификацию (SP-41), или вы можете посетить автомобильное агентство , чтобы сделать это.

Плата за повторную сертификацию не взимается.

Принимаются только оригиналы документов; ксерокопии не допускаются.

Если вы не получили уведомление о продлении

Если вы не получили уведомление о продлении по почте, вы можете загрузить Заявление на получение номерных знаков для транспортных средств и / или Табличку для лиц с ограниченными возможностями (форма SP-41).
Также ознакомьтесь с доступным контрольным списком инструкций (форма SP-41A), чтобы убедиться, что у вас есть вся необходимая информация для полного заполнения заявки и избежания задержек в обработке.
Отправьте заполненную заявку на номер:

Комиссия по автотранспортным средствам Нью-Джерси
Специальная табличка
225 East State Street
PO Box 15
Trenton, NJ 08666-0015

ИЛИ вы можете позвонить в отдел специальных номеров MVC по телефону 609-292-6500, чтобы отправить вам заявку и контрольный список.

Медицинская повторная сертификация

По закону каждые три года требуется справка от квалифицированного практикующего врача, подтверждающая вашу квалификацию на таблички или таблички с символами инвалидной коляски.Медицинское свидетельство должно быть выдано в течение 60 дней с момента подачи.
ваше приложение. Доступна подробная информация о квалификациях.

Как заменить утерянные, украденные или поврежденные документы

  • Если вы заменяете табличку «Лицо с инвалидностью», вы можете посетить агентство по продаже транспортных средств или отправить запрос по почте.
    • Если вы посещаете автомобильное агентство, принесите оригинал удостоверения личности инвалида, ваши водительские права или удостоверение личности, не относящееся к водителю, табличку и заполненное Заявление на получение номерных знаков.
      и / или табло для лиц с ограниченными возможностями (форма SP-41).

      • Плата за замену не взимается.
    • Если вы потеряли удостоверение личности с инвалидностью и табличку, вы можете обратиться в автотранспортное агентство с нотариально заверенным заявлением, подтверждающим потерю этих предметов, или заполнить подписанный
      письмо в присутствии сотрудника MVC.

      • Если ваш плакат украли, требуется заявление в полицию.
      • Плата за замену не взимается.
    • Если вы отправляете запрос по почте, загрузите Заявление на получение номерных знаков транспортного средства и / или таблички для лиц с ограниченными возможностями (форма SP-41). Также просмотрите
      Контрольный список инструкций (форма SP-41A), чтобы убедиться, что у вас есть вся необходимая информация для полного заполнения заявки и избежания задержек в обработке.
    • Если владелец плаката не может посетить автомобильный офис, он может уполномочить кого-либо подать заявление от его имени. Это лицо должно предоставить нотариально заверенное письмо-разрешение, подписанное владельцем или властью.
      адвоката, дающего им разрешение на ведение автотранспортных операций в отсутствие владельца.

Отправьте заявку по адресу:

New Jersey Motor Vehicle Commission
Special Plate Unit
225 East State Street
PO Box 15
Trenton, NJ 08666-0015
ИЛИ вы можете позвонить по телефону 609-292-6500, чтобы отправить вам заявление и контрольный список.

Таблички временной парковки

Временные табло выдаются на шесть месяцев с возможностью продления на шесть месяцев. Заявки на временные плакаты следует подавать лично начальнику муниципальной полиции, а не в МВЦ.

  • Чтобы подать заявку на временную парковочную табличку, необходимо выполнить следующие действия:
    • Заполните заявление на получение временного плаката (форма SP-68) или посетите местное муниципальное отделение полиции, чтобы получить заявление.
    • Получите у квалифицированного практикующего врача свидетельство о том, что вы имеете право на временную табличку; информацию о медицинской сертификации см. в разделе Квалификация.
    • Отправьте заполненное заявление в муниципальное отделение полиции вместе с чеком или денежным переводом на 4 доллара, подлежащим оплате в NJMVC.

После рассмотрения и утверждения начальником муниципальной полиции его отдел выдаст вам временную табличку.

Повторное исследование статуса малярийных паразитов (Plasmodium sp.) У индийских нечеловеческих приматов

Abstract

Многие паразиты и патогены человека имеют близких родственников среди нечеловеческих приматов. Например, приматы, не являющиеся человеком, являются носителями нескольких видов малярии, вызывающей паразиты из рода Plasmodium. Исследования показывают, что для лучшего понимания происхождения и эволюции малярийных паразитов человека важно знать разнообразие и эволюционные отношения этих паразитов у нечеловеческих приматов.Была проведена большая работа по изучению малярийных паразитов у диких обезьян в Африке, а также у диких обезьян Юго-Восточной Азии, однако исследования в Южной Азии, особенно в Индии, отсутствуют. Индия является одним из основных регионов мира, подверженных малярии, и демонстрирует высокое разнообразие приматов, что, в свою очередь, обеспечивает идеальные условия как для зоонозов, так и для антропозоонозов. В этом исследовании мы сообщаем молекулярные данные по паразитам малярии из диких популяций индийских приматов, кроме человека. Мы исследовали 349 образцов фекалий пяти различных индийских приматов, кроме человека, 94 образца крови и тканей одного из индийских видов приматов (Macaca radiata) и один образец крови M.мулатта. Наши результаты подтверждают присутствие P. fragile, P. inui и P. cynomolgi в ​​Macaca radiata. Кроме того, мы впервые сообщаем о присутствии малярийного паразита человека, P. falciparum, у M. mulatta и M. radiata. Кроме того, наши результаты показывают, что M. radiata не демонстрирует популяционную структуру, вероятно, из-за опосредованной человеком транслокации проблемных обезьян. Опосредованная человеком транспортировка макак добавляет дополнительный уровень сложности борьбе с малярией у человека. Эта проблема имеет значение как для распространения малярии приматов, так и для человека.

Информация об авторе

Приматы, не являющиеся людьми, — наши ближайшие родственники, и вместе с ними мы разделяем многие наши болезнетворные патогены. Малярия является одним из таких примеров, когда паразит (Plasmodium), вызывающий малярию у людей, произошел от популяций нечеловеческих приматов. Чтобы понять происхождение и эволюцию малярийных паразитов человека, важно знать разнообразие и эволюционные отношения этих паразитов у нечеловеческих приматов. В этом исследовании мы сообщаем молекулярные данные по паразитам малярии из диких популяций индийских приматов, кроме человека.Мы исследовали 349 образцов фекалий пяти различных индийских приматов, кроме человека, и 94 образца крови и тканей одного из индийских приматов (Macaca radiata). Наши результаты подтверждают присутствие P. fragile, P. inui и P. cynomolgi в ​​Macaca radiata. Кроме того, мы впервые сообщаем о присутствии малярийного паразита человека, P. falciparum, у M. mulatta и M. radiata.

Образец цитирования: Диксит Дж., Захария А., П. К. С., Чандрамохан Б., Шанмуганатхам В., Карант К. П. (2018) Повторное исследование статуса малярийного паразита (Plasmodium sp.) у индийских нечеловеческих приматов. PLoS Negl Trop Dis 12 (12):
e0006801.

https://doi.org/10.1371/journal.pntd.0006801

Редактор: Алехандро Льянос-Куентас, Университет Перуана Кайетано Эредиа, PERU

Поступила: 28 февраля 2018 г .; Принята в печать: 29 августа 2018 г .; Опубликовано: 6 декабря 2018 г.

Авторские права: © 2018 Dixit et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все вновь созданные последовательности гена Plasmodium Cyt-b были депонированы в репозиторий последовательностей GenBank под номерами доступа: P. inui (MH974123-MH974133), P. falciparum (MH974139-MH

  • 0), P. cynomolgi (MH974122), P. fragile (MH974134-MH974138). Все вновь созданные последовательности гена Plasmodium MSP-142 были депонированы в репозитории последовательностей GenBank под номерами доступа: P inui (MH974141, MH974143-MH974146), P. cynomolgi (MH974142). Все вновь созданные последовательности гена рРНК Plasmodium 18s были депонированы в репозиторий последовательностей GenBank под номерами доступа: P.inui (MH
  • 6-MH

  • 3), P. cynomolgi (MH
  • 5). Все вновь созданные последовательности D-петли Macaca radiata были депонированы в репозиторий последовательностей GenBank под номерами доступа MH974147-MH974228.

    Финансирование: Эта работа была поддержана Индийским советом медицинских исследований Дели (80/801/2013-ECD-I) и партнерской программой DBT-IISc. Спонсор не имел никакого отношения к дизайну исследования, сбору и анализу данных, принятию решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

    Введение

    За последние два десятилетия была проделана большая работа для понимания эволюционного происхождения малярийного паразита человека. Молекулярная филогения приматов, заражающих Plasmodium, предполагает, что основные возбудители малярии у людей (P. falciparum, P. vivax, P. malariae и P. ovale) связаны с Plasmodium, заражающими нечеловеческих приматов, и имеют множественное независимое эволюционное происхождение [ 1–4]. Например, исследования показывают, что P. falciparum происходит от горилл, а не от древних людей [5].В основном азиатский малярийный паразит P. vivax, по-видимому, имеет африканское происхождение, поскольку он связан с Plasmodium, заражающим человекообразных обезьян в Африке [6]. Эти исследования показывают, что для понимания происхождения, эволюции и передачи этих патогенов человека, происходящих от приматов, необходимо, чтобы мы понимали разнообразие и филогенетическое сродство этих патогенов в их естественных хозяевах, нечеловеческих приматах (далее называемых приматами). . Кроме того, постоянный мониторинг разнообразия Plasmodium у диких приматов может предупредить нас о новых видах Plasmodium, которые могут распространиться среди людей.Например, недавно обнаруженная малярия knowlesi у человека из Юго-Восточной Азии была получена от диких макак, которые служат их резервуарными хозяевами [7–11].

    Исследования также показали, что приматы служат резервуарами для Plasmodium, недавно приобретенного людьми от приматов [12–14]. Например, патогены, связанные с P. falciparum, могут естественным образом циркулировать в некоторых популяциях обезьян в Африке [15, 16]. Кроме того, в настоящее время имеются данные о множественной передаче Plasmodium от человека приматам [4, 15–20].Это связано с тем, что даже если малярия полностью искоренена среди людей, в долгосрочной перспективе животные-резервуары могут стать источником рецидивирующей инфекции малярии [21–23]. Такие антропозоонозы (патогены, передающиеся от человека популяциям животных) также имеют важное значение для сохранения, поскольку многие виды приматов находятся под угрозой исчезновения, а их популяции могут сокращаться из-за распространения малярии человека среди приматов.

    Индия, в которой обитает более 15 видов приматов, входит в число стран с высоким разнообразием приматов [24].Из этих 15 видов три широко распространены, а остальные имеют ограниченное распространение. К широко распространенным видам относятся лангур Хануман (Semnopithecus sp.), Распространенный по всей Индии, макака-резус (Macaca mulatta), распространенная на севере Индии, и макака шляпная (Macaca radiata), распространенная в Южной Индии. Эти обезьяны довольно распространены по всей Индии, а также встречаются в городах и деревнях. Кроме того, они считаются священными и часто предоставляются людьми. В то время как в других частях Индии эти обезьяны нападают на посевы и считаются вредителями [25].Таким образом, в Индии существует много взаимодействий между людьми и приматами, что, в свою очередь, предоставляет широкие возможности для передачи болезней. Однако очень мало известно о распространенности, разнообразии и распространении малярийных паразитов у индийских приматов. До настоящего времени сообщалось по крайней мере о трех специфических для приматов видах Plasmodium из M. radiata в Южной Индии, включая P. inui, P. cynomolgi и P. fragile [26–29]. В Шри-Ланке об этих паразитах сообщалось от M. sinica, который тесно связан с M.радиата. Кроме того, P. cynomolgi был зарегистрирован у лангуров (Semnopithecus priam) в Шри-Ланке [30, 31]. И P. inui, и P. cynomolgi также заражают многих приматов Юго-Восточной Азии, тогда как P. fragile является эндемиком макак Индии и Шри-Ланки. Интересно, что большинство этих сообщений о малярии у диких индийских приматов поступает из регионов с высоким уровнем дождя на юго-западе Индии, вероятно, из-за ограниченного распространения переносчика, Anopheles elegans, который ограничен вечнозелеными лесами [32–34].

    Учитывая, что Индия является одним из наиболее подверженных малярии регионов в мире и демонстрирует большое разнообразие видов приматов, вполне вероятно, что человеческий Plasmodium (особенно P. falciparum и P. vivax) мог быть передан индийским приматам, и эти популяции приматов могли также представляют собой источник повторяющейся малярийной инфекции у человека. Следовательно, индийские приматы могут представлять как источник, так и приемник Plasmodium, заражающего людей. Кроме того, индийские приматы могут являться местом обитания гораздо большего числа видов плазмодиев, чем сообщалось до сих пор.Например, генетические исследования показывают, что существует множество «загадочных» видов Plasmodium и других родов малярийных паразитов у ящериц и птиц, поэтому текущие оценки разнообразия простейших, вызывающих малярию, вероятно, будут низкими [1]. Тесное взаимодействие между людьми и приматами в Индии может способствовать развитию как зоонозов, так и антропозоонозов. Кроме того, нерегулируемая опосредованная человеком транслокация «проблемных обезьян» может еще больше ускорить распространение этих патогенов. До настоящего времени не было опубликованных отчетов о генетическом разнообразии Plasmodium и их филогенетическом сходстве у индийских приматов, обитающих на свободном ареале.Однако такие исследования проводились на приматах Юго-Восточной Азии (SEA) [7, 35–38]. Таким образом, здесь мы пытаемся ответить на следующие вопросы: Какие виды плазмодиев заражают индийских приматов? Каковы филогенетические отношения между этими видами Plasmodium и как они связаны с видами Plasmodium, изолированными от других приматов, а также от человека? Какое влияние оказала опосредованная человеком транслокация на популяционную структуру широко распространенных видов хозяев?

    Чтобы ответить на эти вопросы, мы собрали образцы тканей печени и селезенки, крови и фекалий у нескольких видов приматов из Индии.Большая часть сбора образцов была сосредоточена на юго-западе Индии, где ранее регистрировалась обезьянья малярия. Эти образцы использовались для амплификации маркеров хозяев и паразитов, чтобы лучше понять структуру популяции хозяев и разнообразие обезьяньей малярии в Индии.

    Материалы и методы

    Образцы

    Образцы кала.

    Образцы фекалий пяти видов приматов (Macaca radiata, M. mulatta, M. sinica, M. fascicularis umbrosa и Symnopithecus hypoleucus) были собраны в течение 2014-15 годов в семи штатах (Карнатака, Керала, Андхра-Прадеш, Телангана). , Дели, Бихар и Андаманские и Никобарские острова) Индии.Детали расположения образцов, собранных у каждого вида приматов, показаны на рис. 1 и в таблице S1. Свежесобранные фекальные массы целиком, а иногда и части хранились в стерильных флаконах с 70% спиртом или в соотношении 1: 1 с РНК позже при комнатной температуре в полевых условиях и хранились в лаборатории при -20 ° C до экстракции ДНК.

    Образцы крови и тканей.

    В случае Macaca radiata из Кералы и несколько образцов крови и тканей из Карнатаки были предоставлены другими исследователями.Двадцать семь образцов из Вайнада (11 образцов печени, 8 селезенки и 8 крови) и двенадцать образцов крови из Кольпетты были собраны лесным департаментом Кералы у мертвых животных, найденных в лесу в течение 2014-15 годов. Еще 51 образец крови был получен от содержащихся в неволе макак из зоопарка Тричур (Керала) в течение 2015 года. Кроме того, в течение 2015 года четыре образца крови из Карнатаки были получены в Центре исследования приматов (КНР) в кампусе Индийского института наук (IISc Bangalore), где кровь у макак была взята для стандартного скрининга на заболевания.Образец крови содержащихся в неволе M. mulatta, инфицированных P. cynomolgy, в лабораторных условиях был получен из CDRI Lucknow.

    Молекулярные данные пробы фекалий

    Извлечение ДНК из образцов фекалий и обнаружение ДНК хозяина.

    ДНК из образцов фекалий экстрагировали с помощью набора для быстрого выделения ДНК QIAamp (Qiagen). Затем каждый образец фекалий тестировали на присутствие ДНК хозяина с использованием опубликованного набора праймеров, специфичных для каждого вида хозяев. Для M. radiata мы использовали опубликованный набор праймеров LqqF: 5 ’TCCTAGGGCAATCAGAAAGAAAG и TDKD: 5’ CCTGAAGTAGGAACCAGATG для амплификации участка митохондриальной D-петли размером ~ 540 п.н. [39].Для M. fascicularis umbrosa и M. mulatta мы использовали другой опубликованный набор праймеров Saru-4F: 5 ’ATCACGGGTCTATCACCCTA и Saru-5r: 5’ GGCCAGGACCAAGCCTATTT для амплификации 630 п.н. области митохондриальной D-петли [40]. Для M. Silenus мы использовали опубликованный набор праймеров D1: 5 ‘GTACACTGGCCTTGTAAACC 3’) и D3: 5 ‘CTTATTTAAGGGGAACGTGTGG 3’ для гипервариабельной области-I (HVR-I) для обнаружения ДНК хозяина (размер ампликона 650 п.н.) [ 41]. Для обнаружения присутствия ДНК Semnopithecus hypoleucos в фекальном материале область митохондриального цитохрома b (Cyt-b) была амплифицирована с использованием праймеров Langur_CytbF: 5 ’ATTATCGCARCCTTCACAATC и L2_CytbR: 5’ TTGTGRAGTATRGGTAY size] [amplicon 320] (amplicon 320 bpRAT).Для всех пар праймеров соблюдались опубликованные температура отжига и условия цикла ПЦР. Всего 4 мкл продукта ПЦР визуализировали гель-электрофорезом на 2% агарозном геле. Образцы, показывающие амплификацию ДНК хозяина, затем подвергали скринингу на паразитов малярии и дальнейшему анализу, тогда как образцы, показывающие отсутствие амплификации, не включали в дальнейший анализ.

    ПЦР для диагностики малярии с использованием гена цитохрома b из фекалий.

    Каждый образец фекалий, обнаруженный положительным на ДНК хозяина, затем подвергался скринингу на наличие малярийного паразита с использованием праймеров, специально разработанных с помощью компьютерной программы PrimerSelect (компонент DNASTAR, Мэдисон, Висконсин, США) для амплификации фрагмента Plasmodium Cytochrome b размером 200 пар оснований. (Cyt-b) ген.Внешние праймеры Cyt-b Cyt-b3F: 5’GGWCAAATGAGTTATTGRG и Cyt-b 3R: 5’CATAGAATGMACACATAAACC амплифицировали продукт ПЦР размером 350 п.н. Участок гена Cyt-b паразита длиной 200 п.н. Первичную ПЦР-амплификацию с использованием внешних праймеров проводили в объеме 25 мкл реакции с использованием 2 мкл экстрагированной тотальной геномной ДНК, 1,5 мМ MgCl 2 , 1х буфера для ПЦР, 0,25 мМ каждого дезоксинуклеозидтрифосфата, 0.4 мМ каждого внешнего праймера и 0,25 ед / мкл полимеразы NEB taq (New England Biolabs Inc.). Первичные условия ПЦР: начальная денатурация при 95 ° C в течение 5 минут, затем 35 циклов (94 ° C в течение 40 секунд, 45 ° C в течение 30 секунд и 72 ° C в течение 30 секунд) и окончательное удлинение при 72 ° C в течение 4 мин. Вторая вложенная ПЦР имела общий объем 25 мкл и состояла из 2 мкл продукта первичной ПЦР, 0,3 мкл (1,5 единицы) ДНК-полимеразы Taq (New England Biolabs Inc.), 1 мМ dNTP, 1 мкМ каждого внутреннего праймера. Условия цикла были такими же, как указано выше, за исключением того, что количество циклов было ограничено до 25.Образец фекалий лабораторно инфицированных (P. cynomolgy) M. mulatta использовали в качестве положительного контроля для ПЦР.

    Молекулярные данные образцы крови и тканей

    Извлечение ДНК из образцов крови и тканей и диагностика малярии.

    ДНК из образцов крови и тканей экстрагировали с помощью набора DNeasy blood and fabric (Qiagen, Германия) по стандартному протоколу. Затем каждый образец подвергался скринингу на наличие малярийных паразитов с помощью вложенной ПЦР с использованием праймеров для фрагмента гена Cyt-b размером 1200 п.н., которые использовались в предыдущих исследованиях [36] и приведенных там ссылках.Внешние праймеры Cyt-b были прямым: 5’TGTAATGCCTAGACGTATTCC и обратным: 5’GTCAAWCAAACATGAATATAGAC, а внутренние праймеры были прямым: 5 ’TCTATTAATTTAGYWAAAGCAC и обратным: 5’GCTTGGGAGCTGTAATCATAAT. Первичные ПЦР-амплификации проводили в объеме 25 мкл реакции с использованием 20 нг общей геномной ДНК, 1,5 мМ MgCl 2 , буфера 1xPCR, 0,6 мМ каждого дезоксинуклеозидтрифосфата, 0,4 мМ каждого праймера и 0,25 ед. / Мкл NEB Taq. полимераза (New England Biolabs). Первичные условия ПЦР были такими же, как указано в [36].В общей сложности 25 мкл вторичной ПЦР запускали с использованием 0,1 мкл (0,5 единицы) ДНК-полимеразы Taq (New England Biolabs Inc.), 0,6 мМ dNTP, 0,4 мкМ каждого праймера (прямой и обратный). Условия вторичного термоциклирования ПЦР были такими же, как указано в [36]. Образец крови из лабораторно инфицированных (P. cynomolgy) M. mulatta использовали в качестве положительного контроля для ПЦР.

    4 мкл продуктов амплификации гена Cyt-b визуализировали с помощью электрофореза на 2% агарозном геле, а успешно амплифицированные продукты подвергали прямому секвенированию с использованием капиллярного секвенатора ABI 3730 и идентифицировали как Plasmodium с помощью BLAST [43].

    Данные ядерных маркеров паразита.

    Помимо митохондриального маркера, мы также попытались амплифицировать части двух ядерных генов (1) MSP-1 42 (кодирующего основной антиген паразита) и (2) 18s рРНК из образцов крови и тканей, положительных на Plasmodium.

    1. Ранее опубликованные пары праймеров были использованы для амплификации участка MSP-1 размером ~ 900 п.н. 42 гена Вперед: 5’GACCAAGTAACAACGGGAG и обратный: 5’CAAAGAGTGGCTCAGAACC [36], ПЦР была проведена в конечном объеме 25 мкл с 20 нг общей геномной ДНК, 1.5 мМ MgCl 2 , буфер 1xPCR, 0,6 мМ каждого дезоксинуклеозидтрифосфата, 0,4 мМ каждого праймера и 0,03 ед. / Мкл ДНК-полимеразы AmpliTaq Gold (Applied Biosystems, Roche, США). Условия термоциклирования ПЦР были такими же, как указано в [36].
    2. Для вложенного гена 18s рРНК проводили ПЦР с использованием двух наборов праймеров. Для первичной ПЦР мы использовали опубликованную пару праймеров rPLU1: 5 ’TCAAAGATTAAGCCATGCAAGTGA и rPLU5: 5 ′ CCTGTTGTTGCCTTAAACTCC [44]. Для вторичной ПЦР использовали разработанные в настоящее время праймеры rUNIF1: 5 ‘TTAAGCCATGCAAGTGAAAGTAT-3′ и rUNIR1: 5’-CGGTATCTGATCGTCTTC.Первую амплификацию ПЦР проводили в конечном объеме 25 мкл, который включал 10 пмоль каждой пары праймеров, 0,2 мМ dNTP, 1 ед. Taq-полимеразы (NEB Biolabs), 1х буфер для ПЦР и 20 нг общей геномной ДНК. Условия цикла включали начальную денатурацию при 95 ° C в течение 5 минут, затем 35 циклов по 1 минуте денатурации при 95 ° C, 1 минуту отжига при 55 ° C, 1 минуту удлинения при 72 ° C с последующим 5-минутным окончательным удлинением при 72 ° C. ° C. Затем 4 мкл первичного продукта ПЦР использовали в качестве матрицы для вторичной ПЦР с конечным объемом 25 мкл, который включал 10 пмоль каждой пары праймеров, 0.2 мМ dNTP, 1 ед. Полимеразы taq (NEB Biolabs) и 1х буфер для ПЦР.

    Приблизительно 4 мкл продукта ПЦР каждого амплифицированного фрагмента ДНК для обоих генов (18s рРНК и ген MSP-1 42 ) подвергали электрофорезу в 2% агарозном геле с использованием лестницы 100 п.н. (BangloreGenei) для подтверждения размера ампликона. Успешно амплифицированные продукты очищали путем инкубации с экзонуклеазой-I и щелочной фосфатазой креветок (Fermentas, Life Sciences) в термоциклере при 37 ° C в течение 120 минут с последующей инактивацией фермента при 85 ° C в течение 15 минут и подвергали секвенированию с обеих сторон. концы и идентифицировали с помощью поиска BLAST.

    Филогенетический анализ с использованием молекулярных данных паразитов

    Ядерные и митохондриальные маркеры паразитов, секвенированные из образцов крови и тканей хозяина M. radiata, были подвергнуты филогенетическому анализу. Раздельное выравнивание одного митохондриального (Cyt-b) и двух ядерных (MSP-1 42 и 18s рРНК) маркеров было произведено с использованием ClustalW и Muscle, как реализовано в MEGA 5.2 [45], с ручным редактированием. Мы использовали модель GTR + I + G для всех филогенетических анализов на основе результатов JModelTest 2.1.2 [46]. Филогенетические отношения оценивались с использованием методов максимального правдоподобия и байесовского метода с использованием RAxML и MrBayes соответственно. Байесовское дерево было построено в MrBayes [47] со следующими настройками: Цепь Маркова запускалась для 4х10 6 поколений, где выборка производилась каждые 100 поколений, предполагалось, что цепи сходятся, когда среднее стандартное отклонение апостериорной вероятности было ниже 0,01 , первые 25% деревьев были выброшены как выгорающие. Дерево ML было сгенерировано с помощью программы RAxML GUI [48] с 500 репликами начальной загрузки с использованием настроек быстрой начальной загрузки.Таблицы S1 – S3 предоставляют полный список опубликованных последовательностей, используемых для филогенетического анализа настоящего исследования. Африканский паразит приматов P. gonderi был использован для укоренения филогении деревьев генов Cyt-band 18s рРНК, учитывая, что предыдущие исследования показали, что обезьяньи паразиты SEA произошли в Африке [2, 49], а для MSP-1 42 ген Последовательность P. fragile использовалась для укоренения дерева, как и в предыдущем исследовании [36].

    Молекулярные данные хозяина с использованием образцов фекалий

    Опосредованные человеком транслокации видов-хозяев могут значительно изменить распространение их паразитов.Чтобы лучше понять структуру популяции хозяина, мы секвенировали митохондриальную область D-петли из 82 образцов M. radiata (которые показали наличие и отсутствие паразита), представляющих все состояния, в которых они распространены. Компоненты ПЦР и условия цикла были такими же, как указано выше и в [39].

    Филогенетический анализ хозяев.

    Последовательности D-петли хозяина (M. radiata) выравнивали с использованием Muscle в MEGA 5.2. На основе JModelTest 2.1.2 мы использовали обратимую во времени модель с гамма-распределенными скоростями замещения и долей инвариантных сайтов (GTR + G + I) для построения филогенетических отношений между M.radiata популяции. Филогенетические выводы были сделаны с использованием методов максимального правдоподобия и байесовских методов, реализованных в RAxML и MrBayes, соответственно, с использованием параметров, описанных выше.

    Сеть гаплотипов хоста и модель IBD.

    Минимальная охватывающая сеть для полного набора из 82 последовательностей мтДНК M. radiata была оценена с помощью PopART [50] с параметром epsilon, установленным на 0. Кроме того, чтобы проверить, соответствуют ли данные мтДНК M. radiata шкале изоляции по расстоянию (IBD) модель структуры населения [51] программа IBD v1.5 [52] был использован для определения корреляции между попарными генетическими расстояниями (p-расстояние) и географическими расстояниями между парами популяций.

    Результаты

    Образцы кала

    Идентификация хозяина и секвенирование митохондриальных генов хозяина.

    Всего было собрано 349 образцов фекалий пяти различных видов индийских приматов и протестировано на присутствие ДНК хозяина путем секвенирования митохондриальных областей (подробности приведены в Таблице 1 и Таблице S1).Максимальное количество образцов фекалий было собрано у M. radiata, где из 251 собранных образцов фекалий 120 были признаны положительными на присутствие ДНК хозяина. Пятнадцать образцов фекалий из 24 образцов, собранных на M. mulatta, оказались положительными на ДНК хозяина. Для M. fascicularis umbrosa было собрано всего 57 образцов фекалий, и 30 были признаны положительными на ДНК хозяина, в то время как для Symnopithecus hypoleucus были собраны 11 образцов фекалий из двух разных мест, из которых девять образцов были положительными на ДНК хозяина.Кроме того, четыре из шести образцов фекалий, собранных на Macaca Silenus, оказались положительными на ДНК хозяина. Подробная информация об образцах фекалий, собранных у каждого из изученных видов, и количество образцов, положительных на ДНК хозяина, приведены в таблице 1.

    Скрининг фекалий хозяев на ДНК паразитов.

    Всего 178 (положительных по ДНК хозяина) образцов фекалий пяти различных видов индийских приматов, собранных из разных мест Индии, были протестированы на наличие паразита Plasmodium с помощью вложенной ПЦР.Интересно, что, за исключением M. radiata и одного образца M. mulatta, все образцы фекалий других приматов оказались отрицательными на присутствие малярийного паразита. Из 120 образцов фекалий M. radiata 19 образцов (16%) показали присутствие паразита, однако из 15 проверенных образцов M. mulatta только одна показала присутствие паразита (6,6%) (Таблица 1). С помощью вложенной ПЦР из всех образцов с положительной реакцией на паразитов был получен фрагмент размером 200 п.н. Сравнение последовательностей с опубликованными данными (на основе области 200 п.н.) показало, что все последовательности идентичны P.falciparum, последовательности гена Cyt-b. Однако мы не смогли секвенировать какой-либо более крупный фрагмент генома паразита (митохондриальный или ядерный) из этих образцов, вероятно, из-за низкого качества ДНК, полученной из образцов фекалий.

    Образцы крови

    Скрининг образцов крови и тканей хозяина на ДНК паразитов.

    В общей сложности 94 образца крови и тканей M. radiata, собранные из четырех разных мест на юге Индии, были протестированы на наличие паразитов Plasmodium (Таблица 2).Ни у одной из содержащихся в неволе макак из зоопарка Тричур не было обнаружено плазмодиев, однако в образцах диких животных из Вайнада и Колпетты распространенность этого паразита была очень высокой (см. Ниже). Из 27 образцов крови и тканей, собранных у Вайнада, 12 образцов (5 селезенки, 6 образцов печени и 1 кровь) были признаны положительными на ДНК паразита, в то время как 5 образцов из 12 образцов крови, взятых из Колпетты, были положительными на паразитов. Кроме того, паразит был обнаружен у двух содержащихся в неволе макак M. radiata из кампуса КНР IISc (таблица 2).

    Идентификация видов плазмодиев.

    Митохондриальный ген Cyt-b, секвенированный из положительных образцов, был подвергнут поиску BLAST для идентификации видов Plasmodium. Нам удалось амплифицировать и секвенировать 19 последовательностей гена Plasmodium Cyt-b из индийского M. radiata. Анализ BLAST показал 11 последовательностей P. inui, пять P. fragile, две последовательности P. falciparum и одну P. cynomolgi (таблица 2). Всего 61 последовательность (опубликованная и созданная в настоящее время) была выровнена с использованием clustal W в MEGA 5.2 (таблица S2) для филогенетического анализа.Общая длина выровненных последовательностей составила 960 позиций. Интересно, что среди последовательностей индийских P. inui не наблюдалось никаких изменений. Однако расхождение между образцами из Индии и Юго-Восточной Азии составило 0,016 (таблица 3). Расхождение между индейским и шри-ланкийским P. fragile составило 0,005 (таблица 3). Интересно, что в настоящем исследовании был обнаружен только один изолят P. cynomolgi, и он не сильно отличается от остальных последовательностей SEA (0,004, таблица 3). Частичная последовательность гена Cyt-b P. falciparum, выделенная из M.radiata был идентичен P. falciparum, обнаруженному у людей. Чтобы найти какое-либо различие, нам дополнительно необходимо секвенировать весь митохондриальный геном этих изолятов, но мы не смогли этого сделать, возможно, из-за очень низкой паразитемии у изучаемых в настоящее время макак.

    Филогенетический анализ Plasmodium с использованием последовательностей гена Cyt-b.

    Мы использовали методы максимального правдоподобия и байесовские методы для построения филогенетического дерева видов Plasmodium, обнаруженных у индийских макак. Общая филогения этих двух методов была схожей, поэтому на рис. 2 показано только байесовское дерево.

    Рис. 2. Филогенетическое дерево видов Plasmodium на основе митохондриальной области гена Cyt-b.

    Байесовские методы и методы машинного обучения дали похожие древовидные топологии, поэтому показано только байесовское дерево. Значения над ветвями представляют собой апостериорные вероятности вместе со значениями начальной загрузки (выделенными жирным шрифтом) в процентах, полученными для дерева машинного обучения.

    https://doi.org/10.1371/journal.pntd.0006801.g002

    В целом эта филогения аналогична филогении, полученной в предыдущих исследованиях [36], но настоящая филогения дополнительно включает последовательности гена Cyt-b P.inui, P. fragile и P. cynomolgi, обнаруженные у индийской макаки M. radiata. Последовательности гена Cyt-b P. inui, полученные из M. radiata, были монофилетическими, и эта клада была вложена в излучение P. inui, полученного от макак SEA. В случае P. fragile индийские последовательности демонстрируют некоторые вариации и вместе с последовательностями Шри-Ланки образуют отдельную кладу. Единственная последовательность P. cynolmolgi, обнаруженная в этом исследовании, относится к P. cynomolgi, одетому вместе с последовательностями из Шри-Ланки и Юго-Восточной Азии. Кроме того, как и ожидалось, последовательности гена Cyt-b P.falciparum, полученные от индийских макак, были идентичны опубликованным последовательностям P. falciparum. Все вновь созданные последовательности гена Cyt-b плазмодия были депонированы в репозитории последовательностей GenBank под номерами доступа: P. inui (MH974123-MH974133), P. falciparum (MH974139-MH

  • 0), P. cynomolgi (MH974122), P. fragile (MH974134). -MH974138).

    Филогенетический анализ Plasmodium с использованием ядерных генов.

    Ядерные маркеры также были протестированы на амплификацию с образцами кала, однако они не дали положительных результатов.Кроме того, чтобы проверить надежность филогенетических отношений, изображенных на рис. 2, мы секвенируем два ядерных гена (MSP-1 42 и 18s рРНК) из образцов крови и тканей этих макак. Мы смогли получить шесть последовательностей гена MSP-1 42 (пять P. inui и один P. cynomolgi) и девять последовательностей 18s рРНК (восемь P. inui, одна P. cynomolgi) из образцов Plasmodium, полученных из M. radiata (таблица 2). Однако нам не удалось получить последовательности этих генов из остальных образцов, вероятно, из-за низкой паразитемии.

    Последовательности гена MSP-1 42 , полученные из шести (пять P. inui и один P. cynomolgi) изолятов индийского плазмодия, сравнивали с опубликованными последовательностями (таблица S3), доступными для паразитов обезьяньей малярии. В отличие от последовательностей гена Cyt-b, последовательности гена MSP-1 42 сильно расходились среди индийских видов Plasmodium (0,015, таблица 3), а расхождение между последовательностями индийского и SEA P. inui было довольно высоким (0,036, таблица 3). В случае P. cynomolgi среднее расхождение между последовательностями Indian и SEA составило 0.029 (таблица 3). Все вновь созданные последовательности гена Plasmodium MSP-1 42 были депонированы в репозиторий последовательностей GenBank под номерами доступа: P inui (MH974141, MH974143-MH974146), P. cynomolgi (MH974142).

    Фрагмент гена 18s рРНК длиной 429 п.н. секвенировали из двух видов Plasmodium (P. inui и P. cynomolgi), происходящих от индийских макак. Подобно митохондриальному гену Cyt-b, восемь индийских изолятов P. inui ядерного гена 18s рРНК не показали генетических вариаций среди них, и эти последовательности показали очень низкую дивергенцию от других SEA P.inui (0.004, таблица 3). Единственный изолят P. cynomolgi из Индии показал нуклеотидные замены в шести сайтах по сравнению с изолятами P. cynomolgi SEA со значением дивергенции 0,10 (таблица 3).

    Как и в митохондриальном дереве, ядерное дерево MSP- 142 показало, что индийские последовательности P. inui и P. cynomolgi были вложены в их аналоги SEA (Рис. 2 и Рис. 3). В дереве гена 18s рРНК P. cynomolgi из Индии и Юго-Восточной Азии вместе с P. fragile образовали кладу (рис. 4).Однако позиция P. inui осталась нерешенной. В целом дерево генов 18s рРНК было неинформативным в отношении положения P. inui и P. cynomolgi, вероятно, из-за отсутствия последовательностей других видов Plasmodium. Все вновь созданные последовательности гена рРНК Plasmodium 18s были депонированы в репозиторий последовательностей GenBank под номерами доступа: P. inui (MH

  • 6-MH

  • 3), P. cynomolgi (MH
  • 5).

    Рис. 3. Филогенетическое дерево видов Plasmodium на основе ядерного генома MSP-1 42 гена.

    Байесовские методы и методы машинного обучения дали похожие древовидные топологии, поэтому показано только байесовское дерево. Значения над ветвями представляют собой апостериорные вероятности вместе со значениями начальной загрузки (выделенными жирным шрифтом) в процентах, полученными для дерева машинного обучения.

    https://doi.org/10.1371/journal.pntd.0006801.g003

    Рис. 4. Филогенетическое дерево видов Plasmodium на основе гена 18s рРНК ядерного генома.

    Байесовские методы и методы машинного обучения дали похожие древовидные топологии, поэтому показано только байесовское дерево.Значения над ветвями представляют собой апостериорные вероятности вместе со значениями начальной загрузки (выделенными жирным шрифтом) в процентах, полученными для дерева машинного обучения.

    https://doi.org/10.1371/journal.pntd.0006801.g004

    Филогенетический анализ хозяина

    Поскольку мы собрали образцы M. radiata со всей южной части Индии, охватывающей большую часть ее ареала, мы также хотели определить, проявляет ли M. radiata какую-либо популяционную структуру. Поскольку для групп макак характерна женская филопатрия [53], можно ожидать географически структурированного распределения гаплотипов мтДНК.Тем не менее, «проблемные животные» регулярно перемещаются по Индии, чтобы обуздать угрозу обезьян. Эта практика, в свою очередь, может способствовать потоку генов между ранее изолированными популяциями и способствовать распространению патогенов. Таким образом, мы использовали последовательности митохондриальной D-петли, чтобы проверить, могли ли опосредованные человеком транслокации изменить популяционную структуру M. radiata. Байесовское филогенетическое дерево, основанное на последовательностях D-петли, показано на рис. S1. Топология дерева не поддерживает специфическую для климата кластеризацию клад мтДНК, в которой особи сухой и влажной зон не образуют отдельных клад.Таким образом, филогеографическая картина свидетельствует о том, что макаки свободно перемещаются по сухим и влажным зонам страны. Все вновь созданные последовательности D-петли Macaca radiata были депонированы в репозиторий последовательностей GenBank под номерами доступа MH974147-MH974228.

    Сеть гаплотипов хоста и модель IBD

    Минимальная охватывающая сеть из 42 гаплотипов мтДНК M. radiata изображена на рис. S2. Эта сеть включает гаплотипы M. radiata, отобранные по всему ареалу распространения в Южной Индии.Сетевой анализ не выявил географической кластеризации связанных гаплотипов, и в большинстве случаев очень расходящиеся и отдаленно связанные гаплотипы были получены в данной популяции. Более того, в некоторых случаях идентичные гаплотипы были получены из географически удаленных популяций. Таким образом, сеть гаплотипов также предполагает отсутствие популяционной структуры у этого вида. Результаты теста IBD были положительными, но очень низкими (r = 0,298), предполагая недельную корреляцию между генетическим и географическим расстоянием, однако этот результат не был значимым (p = 0.09).

    Обсуждение

    Известно, что индийские макаки, ​​в основном M. radiata, являются носителями по крайней мере трех видов Plasmodium, включая P. fragile, P.inui и P. cynomolgi. Однако большая часть этой работы была проделана в прошлом веке, а с начала 1980-х годов в Индии не проводились исследования малярии приматов. Здесь, используя данные последовательностей Plasmodium, выделенные от приматов-хозяев, и филогенетические анализы, мы подтверждаем присутствие этих патогенов в M. radiata. Кроме того, мы впервые сообщаем о присутствии малярийного паразита человека P.falciparum, у M. mulatta и M. radiata. Это также первый отчет о данных последовательности ДНК, полученных от видов Plasmodium, заражающих дикие популяции индийских макак.

    В целом последовательности P. inui и P. cynomolgi из Индии разветвляются с их аналогами SEA как в ядерных, так и в митохондриальных деревьях. Тем не менее, в некоторых сравнениях расхождение между индийскими последовательностями и последовательностями SEA выше среднего расхождения среди индийских последовательностей. Однако размер выборки очень ограничен. Необходимо провести дополнительные исследования, чтобы определить, представляют ли индийские изоляты другой вид / подвид.Plasmodium, эндемичный для Индийского субконтинента, ветви P. fragile с последовательностями из Шри-Ланки, и этот вид также демонстрирует высокую внутривидовую изменчивость. Среди этих трех паразитов P. cynomolgi был обнаружен у нескольких людей на Никобарских островах [54] и недавно у пациента в Малайзии [55]. Это поднимает вопрос о еще одном малярийном паразите приматов, проявляющем зоонозы. Кроме того, как P. inui, так и P. cynomolgi, как было показано, заражают людей в лабораторных условиях [27, 56] и ссылки в них.Таким образом, вполне возможно, что эти паразиты могут инфицировать людей на материковой части Индии.

    Присутствие малярийных паразитов человека у индийских макак

    Присутствие малярийного паразита человека (P. falciparum) у M. mulatta и M. radiata было неожиданным открытием, но не удивительным, учитывая, что такие наблюдения проводились ранее у других приматов [15, 16]. Однако это открытие вызывает несколько вопросов, смог ли паразит заразить индийских макак или это связано с обнаружением преэритроцитарной стадии паразита.Поскольку настоящее исследование сообщает о паразитах только из фекалий и ткани печени, можно предположить, что обнаружение было связано с преэритроцитарной стадией паразита. Это связано с тем, что бессимптомное преэритроцитарное развитие малярийного паразита млекопитающих происходит в печени, и паразит может достигать фекалий через желчь. Таким образом, метод, основанный на ПЦР, может выявить преэритроцитарную стадию паразитов, а не эритроцитарную инфекцию в крови [57]. Тем не менее, нельзя исключить возможность того, что паразит способен инфицировать эритроциты макака, поскольку для подтверждения размера образца крови было недостаточно.Учитывая этот сценарий, существует острая необходимость в скрининге большего количества образцов крови индийских макак с использованием традиционных методов обнаружения паразитов в крови, а также молекулярных методов. Хотя из-за таких причин, как субмикроскопические инфекции, морфологические неразличимые формы Plasmodium и образцы приматов, являющиеся условно-патогенными (поскольку многие виды приматов находятся под угрозой исчезновения), молекулярные подходы предпочтительнее морфологических данных [4] (и ссылки там в).

    Предыдущие исследования показали, что африканские приматы (обезьяны) имеют по крайней мере шесть специфичных для хозяев линий, представляющих различные виды Plasmodium в пределах подрода Laverania [17].Одна из этих линий тесно связана с P. falciparum человека и, таким образом, называется P. falciparum, как паразиты малярии. Поскольку было обнаружено, что P. falciparum, специфичный для обезьян, генетически более разнообразен, чем P. falciparum человека, было высказано предположение, что P. falciparum человека произошел от паразитов, подобных P. falciparum, обнаруженных у гориллы, в результате одного случая передачи между видами [5]. Эти две линии P. falciparum можно дифференцировать на основе четырех SNP из митохондриального генома [5]. Интересно, что одно из недавних исследований, проведенных в Индии, показало, что несколько индийских людей P.falciparum, общий один из SNP (из четырех вышеупомянутых отличительных SNP) с изолятами, подобными P. falciparum, эти образцы также показали два новых SNP. Более того, они также обнаружили, что индийский человек P. falciparum обладает высоким генетическим и гаплотипическим разнообразием. Авторы приходят к выводу, что индийский человек P. falciparum может принадлежать к предковому ареалу этого вида и, вероятно, межвидовая передача могла произойти в Индии [58, 59]. Наше открытие присутствия P. falciparum у индийских макак в некоторой степени подтверждает эту гипотезу.Однако, основываясь на небольшом фрагменте, который мы могли секвенировать от макак, мы не можем определить, принадлежат ли эти последовательности к специфическим для человека линиям P. falciparum или P. falciparum, подобным линиям, выделенным от нечеловеческих приматов. Таким образом, для дальнейшего понимания происхождения P. falciparum и его механизмов переключения хозяев необходимы дополнительные исследования, нацеленные на индийских нечеловеческих приматов.

    Географическое распространение малярийных паразитов у индийских макак

    Распространение и распространение малярийных паразитов тесно связано с распространением их переносчика и хозяина.Единственный хозяин, известный до сих пор для малярии, специфической для приматов, из Южной Индии, — это M. radiata, которая распространена на большей части полуострова Индии. Однако в большинстве исследований, в том числе и в нашем, сообщается об этих паразитах у M. radiata, распространенных в регионах с большим количеством осадков (влажная зона) на юго-западе Индии. Согласно [32], распространение малярии макак, по-видимому, определяется распространением группы комаров Leucosphyrus, которые в основном обитают в вечнозеленых тропических лесах. Вечнозеленые леса, в свою очередь, ограничены Юго-Западной Индией, а на остальной части полуострова климат полузасушливый (здесь называется засушливой зоной).Вид комаров Anopheles elegans считается переносчиком этих паразитов в Юго-Западной Индии. Тем не менее, в нашем исследовании мы также обнаружили P. inui и P. cynomolgi из популяции в неволе в Бангалоре (КНР, кампус IISc, Бангалор). Происхождение этой популяции в неволе неизвестно, но, скорее всего, происходило из местных источников. Интересно, что в 1960 г. был обнаружен новый паразит, названный P. osmaniae, у обезьян, живущих на свободе в округе Хайдарабад [60]. Позже этот вид был переклассифицирован как P.inui (см. [27, 56]. И Бангалор, и Хайдарабад находятся в засушливой зоне в центральной части полуострова Индии. Эти наблюдения предполагают, что P. inui и P. cynomolgi могут быть более широко распространены в Южной Индии, чем считалось ранее.

    Как мы можем объяснить присутствие этих паразитов у M. radiata из засушливой зоны полуострова Индии? Есть два возможных объяснения. Один из вероятных сценариев состоит в том, что переносчик A. elegans расширил свой ареал в сухую зону, неся с собой паразита и заражая популяции хозяев в сухой зоне.Во-вторых, инфицированные представители видов-хозяев могли рассредоточиться из влажной зоны полуострова Индии в сухую зону, и в этих районах местные виды Anopheles (кроме A. elegans) могли служить переносчиками. Хорошо известно, что в лабораторных условиях многие другие виды Anopheles могут передавать различные малярии макак [27, 56]. Чтобы изучить эти сценарии, мы изучили структуру популяции и филогеографию вида-хозяина, M. radiata.

    Филогеография M. radiata

    Macaca radiata (семейство Cercopithecidae) — широко распространенный и распространенный вид макак, эндемичных для Южной Индии.Он распространен во влажных и сухих зонах полуострова Индии и встречается как в лесных районах, так и в ландшафтах с преобладанием человека. Как и большинство других церкопитеков, эти макаки живут в матрилинейных отрядах, где потомство женского пола остается на своей родной территории, а потомство мужского пола расходится [61]. Такая социальная структура, называемая женской натальной филопатрией, приводит к географической кластеризации гаплотипов мтДНК. Это связано с тем, что мтДНК наследуется по материнской линии и, следовательно, ограничена областью из-за женской натальной филопатрии.Сообщалось о таком структурировании мтДНК у многих видов макак [62, 63].

    Однако опосредованный человеком транспорт макак может нарушить эту популяционную структуру мтДНК. Наше исследование предполагает, что M. radiata не обнаруживает какой-либо популяционной структуры в их мтДНК. Например, нет разделения популяций влажных и засушливых зон, они вкраплены в филогении (S1 рис.). Кроме того, отсутствует географическая структуризация гаплотипов мтДНК по ареалу видов, поскольку образцы, собранные из 16 различных мест, распределены по сети (S2 Рис).Анализ IDB также не поддерживает значительную корреляцию между географическими и генетическими расстояниями. Мы полагаем, что отсутствие популяционной структуры у макак во многом связано с расселением, опосредованным человеком. По всей Индии «проблемные обезьяны», в основном из городских районов, вылавливаются и выпускаются в их «родные» лесные места обитания. Эти городские обезьяны обычно не могут выжить в лесах, так как они привыкли к поиску пищи в городских условиях. Часто эти перемещенные обезьяны затем перемещаются в соседние человеческие жилища в поисках корма.Такая транслокация на большие расстояния приводит к паттерну, наблюдаемому в нашем анализе, где люди из отдаленных мест имеют идентичный гаплотип (Тумкур и Вайнад), а люди из одного и того же места имеют очень разные гаплотипы (Чикболлапур).

    Транспортировка макак через человека добавляет дополнительный уровень сложности борьбе с малярией. Эта проблема имеет значение как для распространения малярии среди приматов, так и среди людей. В случае малярии, специфической для приматов, такие неестественные перемещения будут способствовать более широкому распространению этих патогенов среди их видов-хозяев, что, в свою очередь, предоставит больше возможностей для зоонозов.Учитывая, что Индия нацелена на полную ликвидацию малярии к 2030 году [64], наше исследование рекомендует интенсивный пространственный и временной мониторинг малярии приматов для целостного подхода к борьбе с малярией человека.

    Вспомогательная информация

    S1 Рис. Филогенетическое дерево видов Macaca radiata, основанное на митохондриальной области D-петли.

    Байесовские методы и методы машинного обучения дали похожие древовидные топологии, поэтому показано только байесовское дерево. Значения над ветвями представляют собой апостериорные вероятности вместе со значениями начальной загрузки (выделенными жирным шрифтом) в процентах, полученными для дерева машинного обучения.На рисунке также изображены влажная зона (синий цвет) и сухая зона (коричневый цвет) Юго-Западной Индии. Образцы фекалий хозяина, собранные из соответствующих зон, окрашены соответствующим образом на филогенетическом дереве.

    https://doi.org/10.1371/journal.pntd.0006801.s001

    (TIF)

    Благодарности

    JD благодарит Индийский совет медицинских исследований Дели (ICMR) за стипендию научного сотрудника. Авторы благодарят В. Рамеша из Центра исследования приматов МИНК, доктора С.К. Пури из CDRI Лакхнау, лесного департамента Кералы и чиновникам зоопарка Тричур за предоставленные образцы крови и тканей макак.Джей Ди благодарит Апарну Ладжми, Дивью Б., Кунала Арекара, Майтрейю Сил, Чинту Сидхартхана, В. Дипака и Анирудху Датту Роя за помощь в сборе образцов фекалий во время исследования. JD благодарит Бхавани, сотрудников офиса CES и всех нынешних и бывших сотрудников лаборатории PK в CES за их поддержку.

    Список литературы

    1. 1.
      Ди Фиоре А, Дисотелл Т, Гагнё П, Аяла Ф.Дж. Малярии приматов: эволюция, адаптация и прыжки видов. Экология паразитов приматов: динамика и изучение взаимоотношений паразит-хозяин Кембридж, Великобритания: Издательство Кембриджского университета с.2009: 141–82.
    2. 2.
      Escalante AA, Freeland DE, Collins WE, Lal AA. Эволюция малярийных паразитов приматов на основе гена, кодирующего цитохром b из линейного митохондриального генома. Труды Национальной академии наук Соединенных Штатов Америки. 1998. 95 (14): 8124–9. Epub 1998/07/08. pmid: 9653151; Идентификатор PubMed Central PMCID: PMCPMC20940.
    3. 3.
      Пругнолле Ф., Дюран П., Нил С., Олломо Б., Аяла Ф.Дж., Арнатау С. и др. Африканские человекообразные обезьяны являются естественными хозяевами множества родственных видов малярии, включая Plasmodium falciparum.Труды Национальной академии наук. 2010. 107 (4): 1458–63.
    4. 4.
      Пругнолле Ф., Ружерон В., Бекварт П., Берри А., Маканга Б., Рахола Н. и др. Разнообразие, смена хозяев и эволюция Plasmodium vivax, заражающего африканских человекообразных обезьян. Труды Национальной академии наук. 2013. 110 (20): 8123–8.
    5. 5.
      Лю В., Ли И., Learn GH, Rudicell RS, Robertson JD, Keele BF и др. Происхождение паразита малярии человека Plasmodium falciparum у горилл.Природа. 2010. 467 (7314): 420–5. Epub 2010/09/25. pmid: 20864995; Идентификатор PubMed Central PMCID: PMCPMC2997044.
    6. 6.
      Лю В., Ли И, Шоу К.С., Learn GH, Plenderleith LJ, Malenke JA и др. Африканское происхождение малярийного паразита Plasmodium vivax. Связь природы. 2014; 5: 3346. Epub 2014/02/22. pmid: 24557500; Идентификатор PubMed Central PMCID: PMCPMC4089193.
    7. 7.
      Ли KS, Divis PC, Zakaria SK, Matusop A, Julin RA, Conway DJ и др. Plasmodium knowlesi: резервуарные хозяева и отслеживание появления у людей и макак.Патогены PLoS. 2011; 7 (4): e1002015. Epub 2011/04/15. pmid: 214

      ; Идентификатор PubMed Central PMCID: PMCPMC3072369.

    8. 8.
      Сингх Б., Сунг Л.К., Матусоп А., Радхакришнан А., Шамсул С.С., Кокс-Сингх Дж. И др. Большой очаг естественно приобретенных инфекций Plasmodium knowlesi у людей. Ланцет. 2004. 363 (9414): 1017–24.
    9. 9.
      Сингх США, Прахарадж М., Шарма С., Дас А. Сдвиг парадигмы в передаче трансмиссивных болезней. Журнал новых инфекционных заболеваний. 2016; 1 (4).
    10. 10.
      Vythilingam I, Lim YA, Venugopalan B, Ngui R, Leong CS, Wong ML, et al. Малярия Plasmodium knowlesi — новая проблема общественного здравоохранения в Хулу-Селангоре, Селангор, Малайзия (2009–2013 гг.): Эпидемиологический и энтомологический анализ. Паразиты и векторы. 2014; 7 (1): 436.
    11. 11.
      Уильям Т., Рахман Х.А., Джелип Дж., Ибрагим М.Ю., Менон Дж., Григг М.Дж. и др. Увеличение заболеваемости малярией Plasmodium knowlesi после борьбы с малярией P. falciparum и P. vivax в Сабахе, Малайзия.PLoS игнорирует тропические болезни. 2013; 7 (1): e2026. pmid: 23359830
    12. 12.
      Baird JK. Зоонозы малярии. Медицина путешествий и инфекционные болезни. 2009. 7 (5): 269–77. pmid: 19747661
    13. 13.
      Кокс-Сингх Дж., Дэвис Т.М., Ли К.С., Шамсул С.С., Матусоп А., Ратнам С. и др. Малярия Plasmodium knowlesi у людей широко распространена и потенциально опасна для жизни. Клинические инфекционные болезни. 2008. 46 (2): 165–71. pmid: 18171245
    14. 14.
      Дюваль Л., Арье Ф.Паразиты Ape Plasmodium как источник вспышек заболеваний среди людей. Клиническая микробиология и инфекции. 2012. 18 (6): 528–32. pmid: 22440011
    15. 15.
      Пругнолле Ф., Дюран П., Олломо Б., Дюваль Л., Арье Ф., Арнатау С. и др. Свежий взгляд на происхождение Plasmodium falciparum, наиболее злокачественного возбудителя малярии. Патогены PLoS. 2011; 7 (2): e1001283. Epub 2011/03/09. pmid: 21383971; Идентификатор PubMed Central PMCID: PMCPMC3044689.
    16. 16.
      Пругнолле Ф., Олломо Б., Дюран П., Ялсиндаг Е., Арнатау С., Эльгеро Е. и др.Африканские обезьяны инфицированы штаммами нечеловеческих приматов Plasmodium falciparum. Труды Национальной академии наук Соединенных Штатов Америки. 2011. 108 (29): 11948–53. Epub 2011/07/07. pmid: 21730135; Идентификатор PubMed Central PMCID: PMCPMC3141972.
    17. 17.
      Krief S, Escalante AA, Pacheco MA, Mugisha L, André C, Halbwax M и др. О разнообразии паразитов малярии у африканских обезьян и происхождении Plasmodium falciparum от бонобо. Патогены PLoS. 2010; 6 (2): e1000765.pmid: 20169187
    18. 18.
      Leclerc MC, Hugot JP, Durand P, Renaud F. Эволюционные отношения между 15 видами Plasmodium от приматов нового и старого мира (включая людей): кладистический анализ 18S рДНК. Паразитология. 2004. 129 (Pt 6): 677–84. Epub 2005/01/15. pmid: 15648690.
    19. 19.
      Рамасами Р. Зоонозная малярия — глобальный обзор и потребности в исследованиях и политике. Фронт общественного здравоохранения. 2014; 2: 123. Epub 2014/09/04. pmid: 25184118; Идентификатор PubMed Central PMCID: PMCPMC4135302.
    20. 20.
      Дин М.Л., Дин МП. Исследования передачи обезьяньей малярии и естественного заражения человека Plasmodium simium в Бразилии. Bull World Health Organ. 1966. 35 (5): 805–8. pmid: 5297817
    21. 21.
      Fandeur T, Volney B, Peneau C, De Thoisy B. Обезьяны тропических лесов Французской Гвианы являются естественными резервуарами P. brasilianum / P. malariae malaria. Паразитология. 2000. 120 (1): 11–21.
    22. 22.
      Фауст С, Добсон А.П. Малярии приматов: разнообразие, распространение и понимание зоонозных плазмодий.Одно здоровье (Амстердам, Нидерланды). 2015; 1: 66–75.
    23. 23.
      Вулф Н.Д., Эскаланте А.А., Кареш В.Б., Килборн А., Спилман А., Лал А.А. Популяции диких приматов в исследованиях возникающих инфекционных болезней: недостающее звено? Возникающие инфекционные заболевания. 1998; 4 (2): 149. pmid: 9621185
    24. 24.
      Рунвал М.Л., Мохнот С. Приматы Южной Азии: экология, социобиология и поведение: Кембридж, Массачусетс: Издательство Гарвардского университета; 1977.
    25. 25.
      Наг KSC, Padmanabhan P, Karanth KP.Расширение естественного ареала, артефакт выборки или транслокации, опосредованные человеком? Пределы ареала северного типа Semnopithecus entellus (Dufresne, 1797) (Primates: Cercopithecidae: Colobinae) в полуостровной Индии. Журнал угроз таксонов. 2011; 3 (8): 2028–32.
    26. 26.
      Чоудхури Д. Исследования обезьяньей малярии в Индии и ее потенциала как источника зооноза. Ind J Malariology. 1981; 18: 28–34.
    27. 27.
      Коатни Г.Р., Коллинз В.Е., Уоррен М., Контакос П.Г. Малярии приматов.Малярии приматов. 1971.
    28. 28.
      Коатни Г.Р., Чин З, Контакос П.Г., Король Гонконг. Plasmodium inui, малярийный паразит четвертичного типа обезьян Старого Света, передающийся человеку. Журнал паразитологии. 1966. 52 (4): 660–3. Epub 1966/08/01. pmid: 5969104.
    29. 29.
      Рамакришнан С.П., Мохан Б.Н. Энзоотический очаг обезьяньей малярии у Macaca radiata radiata Geoffroy, Нилгирис, штат Мадрас, Индия. Индийский журнал маляриологии. 1962; 16: 87–94. Epub 1962/03/01. pmid: 144

      .

    30. 30.
      Dissanaike A, Nelson P, Garnham P. Два новых малярийных паразита, Plasmodium cynomolgi ceylonensis subup. ноя и Plasmodium frasite sp. Ноябрь, от Monkeys in Ceylon. 1965.
    31. 31.
      Диссанаике AS. СИМИАН МАЛЯРИЙНЫЕ ПАРАЗИТЫ ЦЕЙЛОНА. Бюллетень Всемирной организации здравоохранения. 1965; 32: 593–7. Epub 1965/01/01. pmid: 14315729; Идентификатор PubMed Central PMCID: PMCPMC2555262.
    32. 32.
      Фуден Дж. Малярия у макак. Международный журнал приматологии.1994. 15 (4): 573–96.
    33. 33.
      Рассел П.Ф. Насекомые и эпидемиология малярии. Ежегодный обзор энтомологии. 1959; 4 (1): 415–34.
    34. 34.
      Саллум М.А., Пейтон Е.Л., Вилкерсон Р.С. Шесть новых видов группы Anopheles leucosphyrus, переосмысление An. elegans и векторные значения. Медицинская и ветеринарная энтомология. 2005; 19 (2): 158–99. Epub 2005/06/17. pmid: 15958025.
    35. 35.
      Актер Р., Витилингам И., Хоу Л.Т., Квист Р., Лим Ю.А., Ситам Ф.Т. и др.Малярия обезьян среди диких макак: первое сообщение из района Хулу Селангор, Селангор, Малайзия. Журнал малярии. 2015; 14: 386. Epub 2015/10/07. pmid: 26437652; Идентификатор PubMed Central PMCID: PMCPMC4595055.
    36. 36.
      Муленбейн М.П., ​​Пачеко М.А., Тейлор Дж. Э., Пралл С. П., Амбу Л., Натан С. и др. Ускоренная диверсификация малярии нечеловеческих приматов в Юго-Восточной Азии: адаптивная радиация или географическое видообразование? Молекулярная биология и эволюция. 2015; 32 (2): 422–39. Epub 2014/11/13. pmid: 25389206; Идентификатор PubMed Central PMCID: PMCPMC4298170.
    37. 37.
      Путапорнтип C, Jongwutiwes S, Thongaree S, Seethamchai S, Grynberg P, Hughes AL. Экология малярийных паразитов, заражающих макак Юго-Восточной Азии: данные по последовательностям цитохрома b. Молекулярная экология. 2010. 19 (16): 3466–76. Epub 2010/07/22. pmid: 20646216; Идентификатор PubMed Central PMCID: PMCPMC2

    38. 2.
    39. 38.
      Seethamchai S, Putaporntip C, Malaivijitnond S, Cui L, Jongwutiwes S. Виды малярии и Hepatocystis у диких макак, южный Таиланд. Американский журнал тропической медицины и гигиены.2008. 78 (4): 646–53. Epub 2008/04/04. pmid: 18385364.
    40. 39.
      Qing-qing L, Ya-ping Z. Молекулярная филогения Macaca, основанная на последовательностях митохондриальной контрольной области. Зоологические исследования. 2004. 25 (5): 385–90.
    41. 40.
      Хаясака К., Исида Т., Хораи С. Гетероплазмия и полиморфизм в основной некодирующей области митохондриальной ДНК у японских обезьян: связь с тандемно повторяющимися последовательностями. Молекулярная биология и эволюция. 1991. 8 (4): 399–415. Epub 1991/07/01.pmid: 1681409.
    42. 41.
      Рам М.С., Марн М., Гаур А., Кумара Х.Н., Сингх М., Кумар А. и др. Доисторические и недавние события Vicariance формируют генетическую структуру и разнообразие исчезающих львинохвостых макак в Западных Гатах: последствия для сохранения. ПлоС один. 2015; 10 (11): e0142597. Epub 2015/11/13. pmid: 26561307; Идентификатор PubMed Central PMCID: PMCPMC4641736.
    43. 42.
      Ashalakshmi N, Nag KC, Karanth KP. Молекулы поддерживают морфологию: видовой статус южноиндийских популяций широко распространенного лангура Хануман.Сохранение генетики. 2015; 16 (1): 43–58.
    44. 43.
      Альтшул С.Ф., Гиш В., Миллер В., Майерс Е. В., Липман Д. Д.. Базовый инструмент поиска локального выравнивания. Журнал молекулярной биологии. 1990. 215 (3): 403–10. pmid: 2231712
    45. 44.
      Сингх Б., А. Б., Кокс-Сингх Дж., Жорж С., А. М. С., Р. Х. Анализ на выявление малярии с вложенной полимеразной цепной реакцией для конкретных видов и видов для эпидемиологических исследований. Американский журнал тропической медицины и гигиены. 1999; 60: 687–92. pmid: 10348249
    46. 45.Тамура К., Петерсон Д., Петерсон Н., Стечер Г., Ней М., Кумар С. MEGA5: анализ молекулярной эволюционной генетики с использованием методов максимального правдоподобия, эволюционного расстояния и максимальной экономии. Молекулярная биология и эволюция. 2011. 28 (10): 2731–9. pmid: 21546353
    47. 46.
      Дарриба Д., Табоада Г.Л., Доалло Р., Посада Д. jModelTest 2: больше моделей, новая эвристика и параллельные вычисления. Природные методы. 2012; 9 (8): 772. Epub 2012/08/01. pmid: 22847109; Идентификатор PubMed Central PMCID: PMCPMC4594756.
    48. 47.
      Huelsenbeck JP, Ronquist F. MRBAYES: Байесовский вывод филогенетических деревьев. Биоинформатика (Оксфорд, Англия). 2001. 17 (8): 754–5. Epub 2001/08/29. pmid: 11524383.
    49. 48.
      Сильвестро Д., Михалак И. raxmlGUI: графический интерфейс для RAxML. Разнообразие и эволюция организмов. 2012. 12 (4): 335–7.
    50. 49.
      Escalante AA, Cornejo OE, Freeland DE, Poe AC, Durrego E, Collins WE и др. История обезьяны: происхождение Plasmodium vivax как паразита малярии человека.Труды Национальной академии наук Соединенных Штатов Америки. 2005. 102 (6): 1980–5. pmid: 15684081
    51. 50.
      Бандельт Х.-Дж., Форстер П., Рёль А. Медианные соединяющиеся сети для вывода внутривидовых филогений. Молекулярная биология и эволюция. 1999. 16 (1): 37–48. pmid: 10331250
    52. 51.
      Райт С. Размер популяции и структура размножения в зависимости от эволюции. Наука. 1938; 87: 430–1.
    53. 52.
      Богонак А. IBD (изоляция по расстоянию): программа для анализа изоляции по расстоянию.Журнал наследственности. 2002. 93 (2): 153–4. pmid: 12140277
    54. 53.
      Эванс Б.Дж., МОРАЛЕС Ю.С., Суприатна Дж., Мельник Д.Дж. Происхождение макак Сулавеси (Cercopithecidae: Macaca) на основании филогении митохондриальной ДНК. Биологический журнал Линнеевского общества. 1999. 66 (4): 539–60.
    55. 54.
      Калра Н. Появление малярийных зоонозов обезьяньего происхождения как естественного явления на Больших Никобарах, Андаманских и Никобарских островах — предварительное примечание. Журнал инфекционных болезней.1980. 12 (1): 49–54. pmid: 7451935
    56. 55.
      Та TH, Хисам С., Ланза М., Джирам А.И., Исмаил Н., Рубио Дж. М.. Первый случай естественного заражения человека Plasmodium cynomolgi. Журнал малярии. 2014; 13 (1): 68.
    57. 56.
      Коатни ГР. Симиановая малярия у человека: факты, последствия и прогнозы. Американский журнал тропической медицины и гигиены. 1968. 17 (2): 147–55. Epub 1968/03/01. pmid: 4869108.
    58. 57.
      Абкалло Х.М., Лю В., Хокама С., Феррейра П. Е., Накадзава С., Маэно Ю. и др.ДНК паразитов малярии на преэритроцитарной стадии обнаруживается с помощью ПЦР в фекалиях и крови хозяев. Международный журнал паразитологии. 2014; 44 (7): 467–73. pmid: 24704779
    59. 58.
      Дас А. Отличительные особенности индийских паразитов малярии. Trends Parasitol. 2015; 31 (3): 83–6. Epub 2015/03/10. pmid: 25748059.
    60. 59.
      Tyagi S, Pande V, Das A. Новое понимание эволюционной истории Plasmodium falciparum на основе анализа последовательности митохондриального генома индийских изолятов.Молекулярная экология. 2014. 23 (12): 2975–87. Epub 2014/05/23. pmid: 24845521.
    61. 60.
      Shortt H, Rao G, Qadri S, Abraham R. Plasmodium osmaniae, малярийный паразит индийской обезьяны Macaca radiata. Журнал тропической медицины и гигиены. 1961. 64 (6): 140–43.
    62. 61.
      Эванс Б.Дж., Суприатна Дж., Мельник Д.Дж. Гибридизация и популяционная генетика двух видов макак в Сулавеси, Индонезия. Эволюция; международный журнал органической эволюции. 2001. 55 (8): 1686–702.Epub 2001/10/03. pmid: 11580028.
    63. 62.
      Kanthaswamy S, Smith DG. Подразделение популяции и поток генов среди диких орангутанов. Приматы. 2002. 43 (4): 315–27. pmid: 12426465
    64. 63.
      Този AJ, Моралес JC, Мельник DJ. Сравнение филогении Y-хромосомы и мтДНК приводит к уникальным выводам об истории эволюции макак. Молекулярная филогенетика и эволюция. 2000. 17 (2): 133–44. pmid: 11083929
    65. 64.
      Сингх США, Сивал Н., Панде В., Дас А. Могут ли смешанные паразитарные инфекции помешать целевой программе ликвидации малярии в Индии? BioMed Research International.2017; 2017.

    RSA | Информация о членстве

    Чтобы присоединиться или продлить свое членство, щелкните здесь. Если у вас есть вопросы о присоединении к RSA или о статусе вашего членства, посетите раздел «Только для участников» на этом веб-сайте и / или свяжитесь с сотрудником RSA по членству Лесли Харрис ([email protected]).

    Обратите внимание, что все членские взносы рассчитаны на календарный год с января по декабрь.

    База данных членства RSA находится в ведении Службы поддержки клиентов KOC.

    Членские взносы RSA не возвращаются.

    Категории членства и сборы

    РАСШИРЕННОЕ ПОЖИЗНЕННОЕ ЧЛЕНСТВО 3 000,00 долл.
    Этот вариант, который включает в себя регистрацию на конференцию RSA, членство в RSA и пожизненную подписку RSQ, выплачивается в полном объеме, 3 000,00 долл. США, при продлении или пятью ежегодными взносами по 600 долл. США.

    ПОЖИЗНЕННОЕ ЧЛЕНСТВО 2 000 долларов США
    Этот вариант, который включает членство в RSA и пожизненную подписку RSQ, оплачивается в полном объеме, 2 000 долларов США.00:00, при продлении или пятью ежегодными платежами по 400 долларов США.

    ОБЫЧНОЕ ЧЛЕНСТВО УРОВНЯ V
    Годовой доход более 115 000 долларов США
    Двухлетний период 315 долларов США; Годовой $ 230
    Включает годовую подписку на RSQ

    ЧЛЕНСТВО ОБЫЧНОГО УРОВНЯ IV
    Годовой доход 95 000 — 114 900 долларов США
    Двухлетний период 275 долларов США; Годовая подписка на RSQ

    : 190 долларов США.

    ОБЫЧНОЕ ЧЛЕНСТВО УРОВНЯ III
    Годовой доход 65 000–94 900 долларов США
    Двухлетний период 230 долларов США; Годовая подписка на $ 180
    Включает годовую подписку на RSQ

    ОБЫЧНОЕ ЧЛЕНСТВО УРОВНЯ II
    Годовой доход составляет от 40 000 до 64 9000 долларов
    Двухлетний 220 долларов: Годовой 170
    Включает годовую подписку на RSQ

    ЧЛЕНСТВО ОБЫЧНОГО УРОВНЯ I
    Годовой доход менее 40 000 долларов
    Двухлетний 185 долларов: Один год 135
    Включает годовую подписку на RSQ

    СТУДЕНЧЕСКОЕ ЧЛЕНСТВО
    120 долларов на два года: 90 долларов на один год
    Включает годовую подписку на RSQ

    ВЫПОЛНЕНИЕ ЧЛЕНСТВА В ФАКУЛЬТЕТЕ
    125 долларов на два года: 80 долларов на один год
    Включает годовую подписку на RSQ

    ИНСТИТУЦИОНАЛЬНОЕ ЧЛЕНСТВО $ 325
    Включает подписку на RSQ plus (для академических отделов) плюс одно бесплатное студенческое членство.

    Партнерский статус Общества риторики Америки

    Организации, которые разделяют заинтересованность Общества в дальнейшем изучении всех аспектов риторики, приглашаются подать заявку на получение статуса аффилированных лиц. Статус аффилированного лица дает два гарантированных места в группах на проводимой раз в два года конференции Общества и ссылку на веб-сайте Общества на веб-сайт партнерской организации, если это необходимо.

    Чтобы подать заявку на получение статуса аффилированного лица, организация должна отправить Исполнительному директору Общества: письмо-заявку, в котором должен быть указан веб-адрес организации [если есть]; копию устава и устава организации; копию последнего выпуска журнала организации [если есть]; и копию последней программы конференции организации [если таковая имеется].

    Исполнительный директор представит заявку организации Правлению Общества на его следующем заседании после получения заявки. После утверждения заявки Советом исполнительный директор направит в организацию письмо-соглашение с указанием характера взаимоотношений и конкретных преимуществ, как описано выше.

    Все партнерские соглашения RSA будут проверяться каждые пять лет Советом директоров RSA, чтобы определить, остаются ли отношения выгодными как для RSA, так и для аффилированной организации.

    Пожалуйста, свяжитесь с Джерардом А. Хаузером, исполнительным директором RSA, [email protected] для рассмотрения.

    Статус заявлений и запрос

    СТАТУС ЗАЯВКИ И ЗАПРОС

    Вы можете проверить, было ли ваше заявление получено приемной комиссией, через веб-сайт Службы подачи заявок и запросов на политехнические курсы Сингапура (SP CASE).

    Все кандидаты будут уведомлены о результатах рассмотрения заявки по электронной почте к середине апреля.

    Часто задаваемые вопросы
    Вопрос 1: Я забыл / не могу распечатать квитанцию ​​подтверждения приложения DAE.Должен ли я приложить квитанцию ​​с подтверждением при подаче подтверждающих документов?
    Вам не требуется прикреплять квитанцию ​​с подтверждением, если вы загружаете свои документы в SP CASE в течение периода подачи заявки.

    Однако, если вы отправляете или отправляете подтверждающие документы лично в One Stop Center (OSC), укажите свое имя, идентификационный номер, номер мобильного телефона и курсы, которые вы подали, на титульном листе ваших подтверждающих документов.

    Чтобы узнать почтовый адрес или местонахождение OSC, вы можете обратиться к Как подать заявку.

    Вопрос 2: Какие подтверждающие документы необходимо предоставить?
    Вам необходимо предоставить фотокопии следующих документов (если применимо):

    • Идентификационный документ
      • NRIC (лицевая и оборотная стороны) для сингапурца, постоянного жителя Сингапура и малайзийского паспорта
      • и студенческого билета (если есть) для не из Сингапура
    • Академическая квалификация
      • Местный: GCE ‘O’ / ‘A’ Levels / IP / ITE (сертификат и академическая справка) / IGCSE из сингапурских средних школ
      • Малайзия: SPM / STPM / UEC / UECV
      • Международный: Сертификат (ы) об образовании и стенограммы / бланк результатов
    • Запись CCA (с включенной оценкой CCA)
      • Для обладателей квалификации GCE ‘O’ / IP
    • Для соискателя курса морского обучения
      • Морской и Портовая администрация Сингапура (MPA) результаты визирования
      • Письмо о спонсорстве судоходной компании (иностранные студенты)

    9 0005

    Вопрос 3: Когда я должен предоставить подтверждающие документы?

    Вы должны предоставить подтверждающие документы в течение 3 рабочих дней с даты закрытия заявки.